Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1216364096:

Variant ID: vg1216364096 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 16364096
Reference Allele: T	Alternative Allele: G
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.71, G: 0.29, others allele: 0.00, population size: 100. )

Flanking Sequence (100 bp) in Reference Genome:

GAATTCGTTTCTTTTTTTTCACCAAAAAATGTTTGACTTAATGTACTTATAATGTTTCACTATGTATAAATCTAATGTTGCAGTGAACTGAAACATTCTT[T/G]
CGCTATTTGCTGAAACATTGTTTTCATATAAGTTGAAACAACACCCGATTTAAACGAGTGAAATATTTTTGATCTACTTAGTGAAACAATTCCGATATAC

Reverse complement sequence

GTATATCGGAATTGTTTCACTAAGTAGATCAAAAATATTTCACTCGTTTAAATCGGGTGTTGTTTCAACTTATATGAAAACAATGTTTCAGCAAATAGCG[A/C]
AAGAATGTTTCAGTTCACTGCAACATTAGATTTATACATAGTGAAACATTATAAGTACATTAAGTCAAACATTTTTTGGTGAAAAAAAAGAAACGAATTC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	53.20%	46.70%	0.11%	0.00%	NA
All Indica	2759	73.10%	26.70%	0.14%	0.00%	NA
All Japonica	1512	24.90%	75.10%	0.00%	0.00%	NA
Aus	269	16.40%	83.60%	0.00%	0.00%	NA
Indica I	595	78.50%	21.30%	0.17%	0.00%	NA
Indica II	465	56.10%	43.70%	0.22%	0.00%	NA
Indica III	913	83.10%	16.90%	0.00%	0.00%	NA
Indica Intermediate	786	67.40%	32.30%	0.25%	0.00%	NA
Temperate Japonica	767	3.50%	96.50%	0.00%	0.00%	NA
Tropical Japonica	504	62.10%	37.90%	0.00%	0.00%	NA
Japonica Intermediate	241	15.40%	84.60%	0.00%	0.00%	NA
VI/Aromatic	96	35.40%	64.60%	0.00%	0.00%	NA
Intermediate	90	48.90%	50.00%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1216364096	T -> G	LOC_Os12g27750.1	upstream_gene_variant ; 532.0bp to feature; MODIFIER	silent_mutation	Average:26.984; most accessible tissue: Zhenshan97 flower, score: 53.595	N	N	N	N
vg1216364096	T -> G	LOC_Os12g27760.1	upstream_gene_variant ; 3839.0bp to feature; MODIFIER	silent_mutation	Average:26.984; most accessible tissue: Zhenshan97 flower, score: 53.595	N	N	N	N
vg1216364096	T -> G	LOC_Os12g27740.1	downstream_gene_variant ; 2879.0bp to feature; MODIFIER	silent_mutation	Average:26.984; most accessible tissue: Zhenshan97 flower, score: 53.595	N	N	N	N
vg1216364096	T -> G	LOC_Os12g27740-LOC_Os12g27750	intergenic_region ; MODIFIER	silent_mutation	Average:26.984; most accessible tissue: Zhenshan97 flower, score: 53.595	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1216364096	NA	4.95E-12	Grain_width	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1216364096	NA	1.90E-06	mr1002	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216364096	NA	1.81E-06	mr1425	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216364096	NA	5.67E-07	mr1471	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216364096	NA	3.92E-07	mr1551	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216364096	NA	7.15E-06	mr1642	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216364096	NA	2.42E-09	mr1002_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216364096	NA	3.70E-07	mr1039_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216364096	NA	1.12E-08	mr1364_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216364096	NA	9.43E-06	mr1379_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216364096	NA	3.78E-17	mr1540_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216364096	NA	9.11E-08	mr1551_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216364096	NA	1.18E-06	mr1623_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216364096	NA	2.21E-08	mr1632_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216364096	NA	6.07E-08	mr1653_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216364096	NA	2.99E-08	mr1696_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216364096	6.47E-07	2.16E-10	mr1705_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216364096	NA	4.98E-18	mr1732_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216364096	NA	9.78E-07	mr1905_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216364096	NA	5.69E-06	mr1910_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216364096	NA	4.13E-09	mr1942_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251