\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1216364096:

Variant ID: vg1216364096 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 16364096
Reference Allele: TAlternative Allele: G
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.71, G: 0.29, others allele: 0.00, population size: 100. )

Flanking Sequence (100 bp) in Reference Genome:


GAATTCGTTTCTTTTTTTTCACCAAAAAATGTTTGACTTAATGTACTTATAATGTTTCACTATGTATAAATCTAATGTTGCAGTGAACTGAAACATTCTT[T/G]
CGCTATTTGCTGAAACATTGTTTTCATATAAGTTGAAACAACACCCGATTTAAACGAGTGAAATATTTTTGATCTACTTAGTGAAACAATTCCGATATAC

Reverse complement sequence

GTATATCGGAATTGTTTCACTAAGTAGATCAAAAATATTTCACTCGTTTAAATCGGGTGTTGTTTCAACTTATATGAAAACAATGTTTCAGCAAATAGCG[A/C]
AAGAATGTTTCAGTTCACTGCAACATTAGATTTATACATAGTGAAACATTATAAGTACATTAAGTCAAACATTTTTTGGTGAAAAAAAAGAAACGAATTC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 53.20% 46.70% 0.11% 0.00% NA
All Indica  2759 73.10% 26.70% 0.14% 0.00% NA
All Japonica  1512 24.90% 75.10% 0.00% 0.00% NA
Aus  269 16.40% 83.60% 0.00% 0.00% NA
Indica I  595 78.50% 21.30% 0.17% 0.00% NA
Indica II  465 56.10% 43.70% 0.22% 0.00% NA
Indica III  913 83.10% 16.90% 0.00% 0.00% NA
Indica Intermediate  786 67.40% 32.30% 0.25% 0.00% NA
Temperate Japonica  767 3.50% 96.50% 0.00% 0.00% NA
Tropical Japonica  504 62.10% 37.90% 0.00% 0.00% NA
Japonica Intermediate  241 15.40% 84.60% 0.00% 0.00% NA
VI/Aromatic  96 35.40% 64.60% 0.00% 0.00% NA
Intermediate  90 48.90% 50.00% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1216364096 T -> G LOC_Os12g27750.1 upstream_gene_variant ; 532.0bp to feature; MODIFIER silent_mutation Average:26.984; most accessible tissue: Zhenshan97 flower, score: 53.595 N N N N
vg1216364096 T -> G LOC_Os12g27760.1 upstream_gene_variant ; 3839.0bp to feature; MODIFIER silent_mutation Average:26.984; most accessible tissue: Zhenshan97 flower, score: 53.595 N N N N
vg1216364096 T -> G LOC_Os12g27740.1 downstream_gene_variant ; 2879.0bp to feature; MODIFIER silent_mutation Average:26.984; most accessible tissue: Zhenshan97 flower, score: 53.595 N N N N
vg1216364096 T -> G LOC_Os12g27740-LOC_Os12g27750 intergenic_region ; MODIFIER silent_mutation Average:26.984; most accessible tissue: Zhenshan97 flower, score: 53.595 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1216364096 NA 4.95E-12 Grain_width Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1216364096 NA 1.90E-06 mr1002 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216364096 NA 1.81E-06 mr1425 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216364096 NA 5.67E-07 mr1471 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216364096 NA 3.92E-07 mr1551 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216364096 NA 7.15E-06 mr1642 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216364096 NA 2.42E-09 mr1002_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216364096 NA 3.70E-07 mr1039_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216364096 NA 1.12E-08 mr1364_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216364096 NA 9.43E-06 mr1379_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216364096 NA 3.78E-17 mr1540_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216364096 NA 9.11E-08 mr1551_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216364096 NA 1.18E-06 mr1623_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216364096 NA 2.21E-08 mr1632_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216364096 NA 6.07E-08 mr1653_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216364096 NA 2.99E-08 mr1696_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216364096 6.47E-07 2.16E-10 mr1705_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216364096 NA 4.98E-18 mr1732_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216364096 NA 9.78E-07 mr1905_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216364096 NA 5.69E-06 mr1910_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216364096 NA 4.13E-09 mr1942_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251