Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1216358136:

Variant ID: vg1216358136 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 16358136
Reference Allele: G	Alternative Allele: C
Primary Allele: C	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 85. )

Flanking Sequence (100 bp) in Reference Genome:

GTTCGTCGAAAACCATCACAGATTAACAGAATCGATGACGGTTTTAAACCGTCACGATGGAGCCCGAGATCTAGTTAGTCTAGCCAAGCCCATTTCCTAT[G/C]
ACGAAAAATAACCTTCATGAATAGCTGCCACGTAGACATTTTTCCATCACAGATTAGCTGCCACATAGGACTTTTTTTCCGTCACGGATTCAAATCGCCA

Reverse complement sequence

TGGCGATTTGAATCCGTGACGGAAAAAAAGTCCTATGTGGCAGCTAATCTGTGATGGAAAAATGTCTACGTGGCAGCTATTCATGAAGGTTATTTTTCGT[C/G]
ATAGGAAATGGGCTTGGCTAGACTAACTAGATCTCGGGCTCCATCGTGACGGTTTAAAACCGTCATCGATTCTGTTAATCTGTGATGGTTTTCGACGAAC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	45.60%	40.20%	4.30%	9.94%	NA
All Indica	2759	70.90%	8.90%	4.02%	16.13%	NA
All Japonica	1512	7.50%	86.50%	5.22%	0.79%	NA
Aus	269	16.00%	78.80%	1.86%	3.35%	NA
Indica I	595	79.70%	4.70%	3.36%	12.27%	NA
Indica II	465	47.10%	15.10%	6.45%	31.40%	NA
Indica III	913	82.10%	4.80%	3.50%	9.53%	NA
Indica Intermediate	786	65.40%	13.20%	3.69%	17.68%	NA
Temperate Japonica	767	3.10%	95.30%	0.78%	0.78%	NA
Tropical Japonica	504	13.90%	73.80%	12.10%	0.20%	NA
Japonica Intermediate	241	7.90%	85.10%	4.98%	2.07%	NA
VI/Aromatic	96	12.50%	83.30%	2.08%	2.08%	NA
Intermediate	90	33.30%	57.80%	6.67%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1216358136	G -> C	LOC_Os12g27730.1	upstream_gene_variant ; 1827.0bp to feature; MODIFIER	silent_mutation	Average:47.055; most accessible tissue: Zhenshan97 panicle, score: 72.468	N	N	N	N
vg1216358136	G -> C	LOC_Os12g27740.1	upstream_gene_variant ; 2551.0bp to feature; MODIFIER	silent_mutation	Average:47.055; most accessible tissue: Zhenshan97 panicle, score: 72.468	N	N	N	N
vg1216358136	G -> C	LOC_Os12g27730-LOC_Os12g27740	intergenic_region ; MODIFIER	silent_mutation	Average:47.055; most accessible tissue: Zhenshan97 panicle, score: 72.468	N	N	N	N
vg1216358136	G -> DEL	N	N	silent_mutation	Average:47.055; most accessible tissue: Zhenshan97 panicle, score: 72.468	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1216358136	6.96E-06	NA	mr1016	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216358136	NA	1.14E-09	mr1018	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216358136	9.72E-06	NA	mr1055	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216358136	1.47E-06	NA	mr1079	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216358136	3.44E-06	NA	mr1132	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216358136	9.59E-06	NA	mr1142	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216358136	NA	1.16E-07	mr1156	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216358136	1.83E-06	NA	mr1178	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216358136	3.44E-06	NA	mr1178	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216358136	NA	7.26E-06	mr1189	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216358136	1.85E-07	NA	mr1390	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216358136	5.66E-06	NA	mr1390	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216358136	NA	1.56E-10	mr1390	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216358136	1.51E-07	NA	mr1490	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216358136	5.88E-06	NA	mr1490	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216358136	1.70E-06	NA	mr1491	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216358136	NA	3.51E-07	mr1790	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216358136	NA	1.60E-06	mr1796	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216358136	NA	5.41E-12	mr1055_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216358136	5.62E-06	3.04E-14	mr1390_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216358136	NA	6.19E-14	mr1490_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251