\
| Variant ID: vg1216347683 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 16347683 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.72, A: 0.28, others allele: 0.00, population size: 107. )
CCGACCCCTCTCTGCAGAAGGATATATTCTAGCTAGACTTTCATTCTCTTCCACCAGCCACGAAAAAAGGAAAATGGCATTTCGGAAAGGTATTTTTCAG[G/A]
CGTGACATTTAGTTTTACAATTGATTAAGGAATCTTTTTTTTTACACAAATGTGCTTCTTCCATGATTTAATCTTTAAAGATCATTTATGTGTCATGTTT
AAACATGACACATAAATGATCTTTAAAGATTAAATCATGGAAGAAGCACATTTGTGTAAAAAAAAAGATTCCTTAATCAATTGTAAAACTAAATGTCACG[C/T]
CTGAAAAATACCTTTCCGAAATGCCATTTTCCTTTTTTCGTGGCTGGTGGAAGAGAATGAAAGTCTAGCTAGAATATATCCTTCTGCAGAGAGGGGTCGG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 24.70% | 16.40% | 0.44% | 58.51% | NA |
| All Indica | 2759 | 4.30% | 21.20% | 0.72% | 73.79% | NA |
| All Japonica | 1512 | 63.60% | 11.40% | 0.07% | 25.00% | NA |
| Aus | 269 | 9.30% | 1.10% | 0.00% | 89.59% | NA |
| Indica I | 595 | 5.70% | 17.00% | 0.00% | 77.31% | NA |
| Indica II | 465 | 4.70% | 40.00% | 3.44% | 51.83% | NA |
| Indica III | 913 | 0.70% | 13.60% | 0.00% | 85.76% | NA |
| Indica Intermediate | 786 | 7.10% | 22.10% | 0.51% | 70.23% | NA |
| Temperate Japonica | 767 | 95.00% | 1.60% | 0.00% | 3.39% | NA |
| Tropical Japonica | 504 | 11.30% | 26.80% | 0.00% | 61.90% | NA |
| Japonica Intermediate | 241 | 72.60% | 10.40% | 0.41% | 16.60% | NA |
| VI/Aromatic | 96 | 31.20% | 3.10% | 0.00% | 65.62% | NA |
| Intermediate | 90 | 36.70% | 11.10% | 0.00% | 52.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1216347683 | G -> DEL | N | N | silent_mutation | Average:36.152; most accessible tissue: Callus, score: 66.511 | N | N | N | N |
| vg1216347683 | G -> A | LOC_Os12g27710.1 | upstream_gene_variant ; 4858.0bp to feature; MODIFIER | silent_mutation | Average:36.152; most accessible tissue: Callus, score: 66.511 | N | N | N | N |
| vg1216347683 | G -> A | LOC_Os12g27720.1 | downstream_gene_variant ; 900.0bp to feature; MODIFIER | silent_mutation | Average:36.152; most accessible tissue: Callus, score: 66.511 | N | N | N | N |
| vg1216347683 | G -> A | LOC_Os12g27730.1 | downstream_gene_variant ; 4687.0bp to feature; MODIFIER | silent_mutation | Average:36.152; most accessible tissue: Callus, score: 66.511 | N | N | N | N |
| vg1216347683 | G -> A | LOC_Os12g27710-LOC_Os12g27720 | intergenic_region ; MODIFIER | silent_mutation | Average:36.152; most accessible tissue: Callus, score: 66.511 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1216347683 | 8.41E-06 | NA | mr1016 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216347683 | 2.84E-06 | NA | mr1017 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216347683 | 3.41E-06 | NA | mr1018 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216347683 | 1.11E-06 | NA | mr1055 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216347683 | 9.76E-07 | NA | mr1132 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216347683 | 7.56E-07 | NA | mr1055_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216347683 | 1.96E-07 | NA | mr1132_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216347683 | 7.55E-07 | NA | mr1178_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216347683 | 1.02E-08 | NA | mr1178_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216347683 | 1.41E-06 | NA | mr1390_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216347683 | 6.58E-09 | NA | mr1390_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216347683 | 1.74E-08 | NA | mr1490_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |