\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1216347683:

Variant ID: vg1216347683 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 16347683
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.72, A: 0.28, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:


CCGACCCCTCTCTGCAGAAGGATATATTCTAGCTAGACTTTCATTCTCTTCCACCAGCCACGAAAAAAGGAAAATGGCATTTCGGAAAGGTATTTTTCAG[G/A]
CGTGACATTTAGTTTTACAATTGATTAAGGAATCTTTTTTTTTACACAAATGTGCTTCTTCCATGATTTAATCTTTAAAGATCATTTATGTGTCATGTTT

Reverse complement sequence

AAACATGACACATAAATGATCTTTAAAGATTAAATCATGGAAGAAGCACATTTGTGTAAAAAAAAAGATTCCTTAATCAATTGTAAAACTAAATGTCACG[C/T]
CTGAAAAATACCTTTCCGAAATGCCATTTTCCTTTTTTCGTGGCTGGTGGAAGAGAATGAAAGTCTAGCTAGAATATATCCTTCTGCAGAGAGGGGTCGG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 24.70% 16.40% 0.44% 58.51% NA
All Indica  2759 4.30% 21.20% 0.72% 73.79% NA
All Japonica  1512 63.60% 11.40% 0.07% 25.00% NA
Aus  269 9.30% 1.10% 0.00% 89.59% NA
Indica I  595 5.70% 17.00% 0.00% 77.31% NA
Indica II  465 4.70% 40.00% 3.44% 51.83% NA
Indica III  913 0.70% 13.60% 0.00% 85.76% NA
Indica Intermediate  786 7.10% 22.10% 0.51% 70.23% NA
Temperate Japonica  767 95.00% 1.60% 0.00% 3.39% NA
Tropical Japonica  504 11.30% 26.80% 0.00% 61.90% NA
Japonica Intermediate  241 72.60% 10.40% 0.41% 16.60% NA
VI/Aromatic  96 31.20% 3.10% 0.00% 65.62% NA
Intermediate  90 36.70% 11.10% 0.00% 52.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1216347683 G -> DEL N N silent_mutation Average:36.152; most accessible tissue: Callus, score: 66.511 N N N N
vg1216347683 G -> A LOC_Os12g27710.1 upstream_gene_variant ; 4858.0bp to feature; MODIFIER silent_mutation Average:36.152; most accessible tissue: Callus, score: 66.511 N N N N
vg1216347683 G -> A LOC_Os12g27720.1 downstream_gene_variant ; 900.0bp to feature; MODIFIER silent_mutation Average:36.152; most accessible tissue: Callus, score: 66.511 N N N N
vg1216347683 G -> A LOC_Os12g27730.1 downstream_gene_variant ; 4687.0bp to feature; MODIFIER silent_mutation Average:36.152; most accessible tissue: Callus, score: 66.511 N N N N
vg1216347683 G -> A LOC_Os12g27710-LOC_Os12g27720 intergenic_region ; MODIFIER silent_mutation Average:36.152; most accessible tissue: Callus, score: 66.511 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1216347683 8.41E-06 NA mr1016 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216347683 2.84E-06 NA mr1017 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216347683 3.41E-06 NA mr1018 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216347683 1.11E-06 NA mr1055 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216347683 9.76E-07 NA mr1132 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216347683 7.56E-07 NA mr1055_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216347683 1.96E-07 NA mr1132_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216347683 7.55E-07 NA mr1178_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216347683 1.02E-08 NA mr1178_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216347683 1.41E-06 NA mr1390_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216347683 6.58E-09 NA mr1390_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216347683 1.74E-08 NA mr1490_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251