Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1216345935:

Variant ID: vg1216345935 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 16345935
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 209. )

Flanking Sequence (100 bp) in Reference Genome:

CATACGTAGTTTCCACCGTATATTTTCCCCTCTTTATCTTTTTATCCCACAAAATAGCATGACCTTTTTTTTAAACATTACTTACGTTTGGGCAATCTCA[C/T]
AACAAACTTTCAACTTAAAAGACAATGCAGAGCCAAAACAAAGAAAAAAATCATTCTGGGCTGAAGTGAGGATGAGGTTTTAGCTAGGATATGTAAAGTT

Reverse complement sequence

AACTTTACATATCCTAGCTAAAACCTCATCCTCACTTCAGCCCAGAATGATTTTTTTCTTTGTTTTGGCTCTGCATTGTCTTTTAAGTTGAAAGTTTGTT[G/A]
TGAGATTGCCCAAACGTAAGTAATGTTTAAAAAAAAGGTCATGCTATTTTGTGGGATAAAAAGATAAAGAGGGGAAAATATACGGTGGAAACTACGTATG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	89.30%	8.50%	0.08%	2.07%	NA
All Indica	2759	96.30%	2.90%	0.04%	0.76%	NA
All Japonica	1512	82.40%	17.30%	0.00%	0.26%	NA
Aus	269	74.00%	16.00%	0.00%	10.04%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	98.10%	1.10%	0.00%	0.86%	NA
Indica III	913	93.90%	5.10%	0.00%	0.99%	NA
Indica Intermediate	786	95.40%	3.40%	0.13%	1.02%	NA
Temperate Japonica	767	96.60%	3.40%	0.00%	0.00%	NA
Tropical Japonica	504	61.30%	38.70%	0.00%	0.00%	NA
Japonica Intermediate	241	81.30%	17.00%	0.00%	1.66%	NA
VI/Aromatic	96	40.60%	11.50%	2.08%	45.83%	NA
Intermediate	90	86.70%	10.00%	1.11%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1216345935	C -> DEL	N	N	silent_mutation	Average:37.181; most accessible tissue: Callus, score: 67.553	N	N	N	N
vg1216345935	C -> T	LOC_Os12g27710.1	upstream_gene_variant ; 3110.0bp to feature; MODIFIER	silent_mutation	Average:37.181; most accessible tissue: Callus, score: 67.553	N	N	N	N
vg1216345935	C -> T	LOC_Os12g27720.1	downstream_gene_variant ; 2648.0bp to feature; MODIFIER	silent_mutation	Average:37.181; most accessible tissue: Callus, score: 67.553	N	N	N	N
vg1216345935	C -> T	LOC_Os12g27710-LOC_Os12g27720	intergenic_region ; MODIFIER	silent_mutation	Average:37.181; most accessible tissue: Callus, score: 67.553	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1216345935	3.58E-06	7.45E-17	mr1016	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216345935	NA	1.71E-16	mr1017	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216345935	1.96E-10	NA	mr1018	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216345935	4.30E-08	1.16E-18	mr1018	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216345935	NA	6.25E-12	mr1019	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216345935	NA	4.16E-08	mr1022	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216345935	4.28E-07	NA	mr1055	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216345935	1.23E-07	4.02E-19	mr1055	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216345935	NA	4.51E-14	mr1079	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216345935	1.29E-07	NA	mr1132	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216345935	3.61E-07	8.44E-19	mr1132	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216345935	NA	8.43E-07	mr1156	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216345935	NA	7.05E-13	mr1178	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216345935	2.17E-06	2.65E-18	mr1390	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216345935	1.75E-07	NA	mr1489	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216345935	NA	1.07E-14	mr1489	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216345935	8.25E-07	3.93E-19	mr1490	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216345935	3.95E-06	NA	mr1491	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216345935	NA	1.05E-14	mr1491	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216345935	NA	5.47E-08	mr1518	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216345935	8.01E-07	NA	mr1778	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216345935	NA	9.01E-06	mr1790	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216345935	3.25E-09	NA	mr1019_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216345935	3.17E-06	2.11E-14	mr1019_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216345935	NA	2.94E-12	mr1022_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216345935	2.02E-06	NA	mr1023_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216345935	9.84E-06	6.84E-17	mr1023_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216345935	3.92E-11	NA	mr1055_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216345935	5.33E-09	6.28E-22	mr1055_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216345935	NA	3.20E-17	mr1079_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216345935	2.32E-09	NA	mr1132_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216345935	4.25E-08	4.87E-23	mr1132_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216345935	3.74E-10	NA	mr1178_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216345935	7.35E-10	1.22E-24	mr1178_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216345935	2.32E-07	NA	mr1261_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216345935	1.59E-06	9.45E-13	mr1261_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216345935	3.16E-10	NA	mr1390_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216345935	1.46E-11	8.22E-28	mr1390_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216345935	1.93E-09	NA	mr1489_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216345935	NA	1.01E-17	mr1489_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216345935	2.74E-08	NA	mr1490_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216345935	9.05E-11	1.97E-26	mr1490_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216345935	NA	3.22E-08	mr1676_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216345935	1.88E-06	NA	mr1778_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216345935	NA	8.59E-14	mr1778_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251