\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1216344665:

Variant ID: vg1216344665 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 16344665
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.89, T: 0.11, others allele: 0.00, population size: 232. )

Flanking Sequence (100 bp) in Reference Genome:


CAAGTGTTGTAGATGGTAGTATACTCTAGACATGGAGGGCATCTGGAATTTTAGATGCCCAACACTCAGTGTCAATGTGTCATCTGTTCTGTGAAACTCA[G/T]
AGAGATCACCAGATTTTGATACTGAGCGTGTTGGGCTTTAGGGAAGTTGCACAGAAAAGAATCTAGAAGATTTTTTCCTCATGTGACATGTAGGACGTGT

Reverse complement sequence

ACACGTCCTACATGTCACATGAGGAAAAAATCTTCTAGATTCTTTTCTGTGCAACTTCCCTAAAGCCCAACACGCTCAGTATCAAAATCTGGTGATCTCT[C/A]
TGAGTTTCACAGAACAGATGACACATTGACACTGAGTGTTGGGCATCTAAAATTCCAGATGCCCTCCATGTCTAGAGTATACTACCATCTACAACACTTG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 68.00% 29.50% 0.15% 2.31% NA
All Indica  2759 56.80% 42.00% 0.22% 1.01% NA
All Japonica  1512 89.00% 10.60% 0.00% 0.33% NA
Aus  269 73.60% 16.70% 0.37% 9.29% NA
Indica I  595 78.20% 21.70% 0.00% 0.17% NA
Indica II  465 54.20% 43.20% 0.65% 1.94% NA
Indica III  913 43.00% 55.90% 0.11% 0.99% NA
Indica Intermediate  786 58.00% 40.60% 0.25% 1.15% NA
Temperate Japonica  767 92.00% 8.00% 0.00% 0.00% NA
Tropical Japonica  504 86.70% 13.30% 0.00% 0.00% NA
Japonica Intermediate  241 84.20% 13.70% 0.00% 2.07% NA
VI/Aromatic  96 35.40% 13.50% 0.00% 51.04% NA
Intermediate  90 78.90% 18.90% 0.00% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1216344665 G -> DEL N N silent_mutation Average:57.543; most accessible tissue: Zhenshan97 flower, score: 73.683 N N N N
vg1216344665 G -> T LOC_Os12g27710.1 upstream_gene_variant ; 1840.0bp to feature; MODIFIER silent_mutation Average:57.543; most accessible tissue: Zhenshan97 flower, score: 73.683 N N N N
vg1216344665 G -> T LOC_Os12g27720.1 downstream_gene_variant ; 3918.0bp to feature; MODIFIER silent_mutation Average:57.543; most accessible tissue: Zhenshan97 flower, score: 73.683 N N N N
vg1216344665 G -> T LOC_Os12g27710-LOC_Os12g27720 intergenic_region ; MODIFIER silent_mutation Average:57.543; most accessible tissue: Zhenshan97 flower, score: 73.683 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1216344665 NA 6.17E-08 mr1022 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216344665 3.46E-06 6.67E-13 mr1079 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216344665 6.35E-06 NA mr1491 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216344665 9.12E-07 NA mr1491 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216344665 2.84E-08 NA mr1022_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216344665 NA 1.37E-09 mr1022_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216344665 1.69E-08 NA mr1023_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216344665 3.40E-06 2.86E-16 mr1023_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216344665 5.31E-09 NA mr1079_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216344665 1.53E-07 1.10E-15 mr1079_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216344665 5.47E-11 NA mr1489_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216344665 7.80E-07 5.03E-16 mr1489_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216344665 4.55E-07 NA mr1778_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216344665 NA 4.37E-14 mr1778_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251