\
| Variant ID: vg1216344665 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 16344665 |
| Reference Allele: G | Alternative Allele: T |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.89, T: 0.11, others allele: 0.00, population size: 232. )
CAAGTGTTGTAGATGGTAGTATACTCTAGACATGGAGGGCATCTGGAATTTTAGATGCCCAACACTCAGTGTCAATGTGTCATCTGTTCTGTGAAACTCA[G/T]
AGAGATCACCAGATTTTGATACTGAGCGTGTTGGGCTTTAGGGAAGTTGCACAGAAAAGAATCTAGAAGATTTTTTCCTCATGTGACATGTAGGACGTGT
ACACGTCCTACATGTCACATGAGGAAAAAATCTTCTAGATTCTTTTCTGTGCAACTTCCCTAAAGCCCAACACGCTCAGTATCAAAATCTGGTGATCTCT[C/A]
TGAGTTTCACAGAACAGATGACACATTGACACTGAGTGTTGGGCATCTAAAATTCCAGATGCCCTCCATGTCTAGAGTATACTACCATCTACAACACTTG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 68.00% | 29.50% | 0.15% | 2.31% | NA |
| All Indica | 2759 | 56.80% | 42.00% | 0.22% | 1.01% | NA |
| All Japonica | 1512 | 89.00% | 10.60% | 0.00% | 0.33% | NA |
| Aus | 269 | 73.60% | 16.70% | 0.37% | 9.29% | NA |
| Indica I | 595 | 78.20% | 21.70% | 0.00% | 0.17% | NA |
| Indica II | 465 | 54.20% | 43.20% | 0.65% | 1.94% | NA |
| Indica III | 913 | 43.00% | 55.90% | 0.11% | 0.99% | NA |
| Indica Intermediate | 786 | 58.00% | 40.60% | 0.25% | 1.15% | NA |
| Temperate Japonica | 767 | 92.00% | 8.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 86.70% | 13.30% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 84.20% | 13.70% | 0.00% | 2.07% | NA |
| VI/Aromatic | 96 | 35.40% | 13.50% | 0.00% | 51.04% | NA |
| Intermediate | 90 | 78.90% | 18.90% | 0.00% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1216344665 | G -> DEL | N | N | silent_mutation | Average:57.543; most accessible tissue: Zhenshan97 flower, score: 73.683 | N | N | N | N |
| vg1216344665 | G -> T | LOC_Os12g27710.1 | upstream_gene_variant ; 1840.0bp to feature; MODIFIER | silent_mutation | Average:57.543; most accessible tissue: Zhenshan97 flower, score: 73.683 | N | N | N | N |
| vg1216344665 | G -> T | LOC_Os12g27720.1 | downstream_gene_variant ; 3918.0bp to feature; MODIFIER | silent_mutation | Average:57.543; most accessible tissue: Zhenshan97 flower, score: 73.683 | N | N | N | N |
| vg1216344665 | G -> T | LOC_Os12g27710-LOC_Os12g27720 | intergenic_region ; MODIFIER | silent_mutation | Average:57.543; most accessible tissue: Zhenshan97 flower, score: 73.683 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1216344665 | NA | 6.17E-08 | mr1022 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216344665 | 3.46E-06 | 6.67E-13 | mr1079 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216344665 | 6.35E-06 | NA | mr1491 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216344665 | 9.12E-07 | NA | mr1491 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216344665 | 2.84E-08 | NA | mr1022_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216344665 | NA | 1.37E-09 | mr1022_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216344665 | 1.69E-08 | NA | mr1023_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216344665 | 3.40E-06 | 2.86E-16 | mr1023_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216344665 | 5.31E-09 | NA | mr1079_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216344665 | 1.53E-07 | 1.10E-15 | mr1079_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216344665 | 5.47E-11 | NA | mr1489_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216344665 | 7.80E-07 | 5.03E-16 | mr1489_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216344665 | 4.55E-07 | NA | mr1778_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216344665 | NA | 4.37E-14 | mr1778_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |