\
| Variant ID: vg1216321310 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 16321310 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 108. )
CAAAAAAAACTTGTGAAAAAGATTGAGTGGATTTGATGAGTAGAGATGGGGGGGAGAGAGGGGAGAAGGGCTTCTCTGCGTGCTCGGGCTCCTAAGTTGG[C/T]
GAAAATGAGTGGGGGAGGAGAAAGGAGGTGGGGCCCGCACGGGTTAAGGGCGCGGCCCACCCAGGGGGAGTGCGGCAGCCTTGCTAGCACCGTGGTGTGT
ACACACCACGGTGCTAGCAAGGCTGCCGCACTCCCCCTGGGTGGGCCGCGCCCTTAACCCGTGCGGGCCCCACCTCCTTTCTCCTCCCCCACTCATTTTC[G/A]
CCAACTTAGGAGCCCGAGCACGCAGAGAAGCCCTTCTCCCCTCTCTCCCCCCCATCTCTACTCATCAAATCCACTCAATCTTTTTCACAAGTTTTTTTTG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 78.10% | 1.60% | 2.79% | 17.54% | NA |
| All Indica | 2759 | 82.80% | 0.40% | 0.87% | 15.95% | NA |
| All Japonica | 1512 | 69.80% | 4.20% | 5.82% | 20.17% | NA |
| Aus | 269 | 78.10% | 0.00% | 1.49% | 20.45% | NA |
| Indica I | 595 | 91.60% | 0.00% | 0.00% | 8.40% | NA |
| Indica II | 465 | 58.50% | 1.90% | 3.87% | 35.70% | NA |
| Indica III | 913 | 90.80% | 0.00% | 0.11% | 9.09% | NA |
| Indica Intermediate | 786 | 81.30% | 0.10% | 0.64% | 17.94% | NA |
| Temperate Japonica | 767 | 96.10% | 0.00% | 0.13% | 3.78% | NA |
| Tropical Japonica | 504 | 23.80% | 12.10% | 15.67% | 48.41% | NA |
| Japonica Intermediate | 241 | 82.20% | 1.20% | 3.32% | 13.28% | NA |
| VI/Aromatic | 96 | 72.90% | 0.00% | 6.25% | 20.83% | NA |
| Intermediate | 90 | 77.80% | 1.10% | 11.11% | 10.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1216321310 | C -> DEL | N | N | silent_mutation | Average:46.409; most accessible tissue: Minghui63 young leaf, score: 64.378 | N | N | N | N |
| vg1216321310 | C -> T | LOC_Os12g27680-LOC_Os12g27690 | intergenic_region ; MODIFIER | silent_mutation | Average:46.409; most accessible tissue: Minghui63 young leaf, score: 64.378 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1216321310 | NA | 7.46E-07 | mr1036 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216321310 | 6.91E-06 | NA | mr1156 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216321310 | 2.50E-06 | NA | mr1156 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216321310 | NA | 4.81E-06 | mr1174 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216321310 | 1.95E-06 | NA | mr1229 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216321310 | NA | 1.93E-06 | mr1382 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216321310 | 2.84E-06 | NA | mr1491 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216321310 | 1.64E-07 | NA | mr1546 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216321310 | 1.96E-06 | 6.58E-07 | mr1587 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216321310 | NA | 2.35E-07 | mr1696 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216321310 | 1.46E-07 | NA | mr1022_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216321310 | 3.14E-07 | NA | mr1023_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216321310 | 5.40E-09 | NA | mr1055_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216321310 | 7.38E-07 | NA | mr1079_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216321310 | 5.54E-07 | NA | mr1132_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216321310 | 5.92E-06 | NA | mr1178_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216321310 | NA | 1.75E-06 | mr1257_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216321310 | 1.87E-07 | NA | mr1390_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216321310 | 1.40E-06 | NA | mr1489_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216321310 | 6.50E-06 | NA | mr1490_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |