\
| Variant ID: vg1216321299 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 16321299 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 105. )
TCTTCGATTTCCAAAAAAAACTTGTGAAAAAGATTGAGTGGATTTGATGAGTAGAGATGGGGGGGAGAGAGGGGAGAAGGGCTTCTCTGCGTGCTCGGGC[T/C]
CCTAAGTTGGCGAAAATGAGTGGGGGAGGAGAAAGGAGGTGGGGCCCGCACGGGTTAAGGGCGCGGCCCACCCAGGGGGAGTGCGGCAGCCTTGCTAGCA
TGCTAGCAAGGCTGCCGCACTCCCCCTGGGTGGGCCGCGCCCTTAACCCGTGCGGGCCCCACCTCCTTTCTCCTCCCCCACTCATTTTCGCCAACTTAGG[A/G]
GCCCGAGCACGCAGAGAAGCCCTTCTCCCCTCTCTCCCCCCCATCTCTACTCATCAAATCCACTCAATCTTTTTCACAAGTTTTTTTTGGAAATCGAAGA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 78.10% | 1.80% | 2.77% | 17.39% | NA |
| All Indica | 2759 | 82.90% | 0.40% | 0.87% | 15.84% | NA |
| All Japonica | 1512 | 69.40% | 4.70% | 6.02% | 19.91% | NA |
| Aus | 269 | 77.70% | 0.00% | 1.86% | 20.45% | NA |
| Indica I | 595 | 91.60% | 0.00% | 0.17% | 8.24% | NA |
| Indica II | 465 | 58.50% | 2.40% | 3.66% | 35.48% | NA |
| Indica III | 913 | 90.80% | 0.00% | 0.11% | 9.09% | NA |
| Indica Intermediate | 786 | 81.40% | 0.10% | 0.64% | 17.81% | NA |
| Temperate Japonica | 767 | 96.10% | 0.00% | 0.39% | 3.52% | NA |
| Tropical Japonica | 504 | 22.40% | 13.50% | 16.07% | 48.02% | NA |
| Japonica Intermediate | 241 | 82.60% | 1.20% | 2.90% | 13.28% | NA |
| VI/Aromatic | 96 | 77.10% | 0.00% | 2.08% | 20.83% | NA |
| Intermediate | 90 | 78.90% | 1.10% | 10.00% | 10.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1216321299 | T -> C | LOC_Os12g27680-LOC_Os12g27690 | intergenic_region ; MODIFIER | silent_mutation | Average:45.868; most accessible tissue: Minghui63 young leaf, score: 64.378 | N | N | N | N |
| vg1216321299 | T -> DEL | N | N | silent_mutation | Average:45.868; most accessible tissue: Minghui63 young leaf, score: 64.378 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1216321299 | NA | 2.41E-06 | mr1036 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216321299 | 5.70E-06 | 5.70E-06 | mr1131 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216321299 | 2.05E-06 | NA | mr1156 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216321299 | 1.36E-06 | NA | mr1236 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216321299 | NA | 8.64E-08 | mr1382 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216321299 | 7.08E-06 | NA | mr1386 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216321299 | NA | 1.66E-06 | mr1414 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216321299 | 4.02E-06 | NA | mr1491 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216321299 | 1.23E-07 | 3.20E-11 | mr1696 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216321299 | NA | 3.39E-09 | mr1696 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216321299 | NA | 2.76E-06 | mr1697 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216321299 | 3.18E-06 | NA | mr1022_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216321299 | 2.16E-06 | NA | mr1023_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216321299 | 1.39E-06 | NA | mr1055_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216321299 | 5.92E-07 | NA | mr1079_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216321299 | 6.34E-06 | NA | mr1132_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216321299 | 2.17E-07 | NA | mr1390_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216321299 | 4.39E-06 | NA | mr1489_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |