Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1216284064:

Variant ID: vg1216284064 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 16284064
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:

GATTATCACCCCACGAAATCGATGTATTGTTAGAGGAGAGGCTGATATATTGGTTGTGCGACCGGGATAAGTAAATCGTCCGTCGGAGACTGGATAGGAG[G/A]
GTGTTCCCCAAGCAGTTGTTACTATTTTCGAGTTCCTGGGAGTTCATACCATGTTCTCAGGAATAATACACAAATGTCCCAATAGGAATCTCGTTTGTTG

Reverse complement sequence

CAACAAACGAGATTCCTATTGGGACATTTGTGTATTATTCCTGAGAACATGGTATGAACTCCCAGGAACTCGAAAATAGTAACAACTGCTTGGGGAACAC[C/T]
CTCCTATCCAGTCTCCGACGGACGATTTACTTATCCCGGTCGCACAACCAATATATCAGCCTCTCCTCTAACAATACATCGATTTCGTGGGGTGATAATC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	35.40%	34.40%	10.33%	19.89%	NA
All Indica	2759	53.20%	13.00%	16.02%	17.83%	NA
All Japonica	1512	12.00%	71.50%	1.72%	14.81%	NA
Aus	269	1.50%	38.30%	1.86%	58.36%	NA
Indica I	595	73.40%	5.40%	12.10%	9.08%	NA
Indica II	465	58.90%	10.10%	16.34%	14.62%	NA
Indica III	913	34.70%	18.70%	19.61%	26.94%	NA
Indica Intermediate	786	55.90%	13.70%	14.63%	15.78%	NA
Temperate Japonica	767	2.30%	97.50%	0.00%	0.13%	NA
Tropical Japonica	504	27.60%	27.20%	4.37%	40.87%	NA
Japonica Intermediate	241	10.00%	81.30%	1.66%	7.05%	NA
VI/Aromatic	96	3.10%	44.80%	3.12%	48.96%	NA
Intermediate	90	18.90%	45.60%	13.33%	22.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1216284064	G -> DEL	N	N	silent_mutation	Average:53.964; most accessible tissue: Zhenshan97 flower, score: 64.273	N	N	N	N
vg1216284064	G -> A	LOC_Os12g27650.1	downstream_gene_variant ; 4183.0bp to feature; MODIFIER	silent_mutation	Average:53.964; most accessible tissue: Zhenshan97 flower, score: 64.273	N	N	N	N
vg1216284064	G -> A	LOC_Os12g27650-LOC_Os12g27670	intergenic_region ; MODIFIER	silent_mutation	Average:53.964; most accessible tissue: Zhenshan97 flower, score: 64.273	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1216284064	2.50E-08	NA	mr1016	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216284064	8.75E-06	NA	mr1016	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216284064	1.48E-06	NA	mr1017	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216284064	2.88E-06	NA	mr1017	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216284064	2.20E-06	NA	mr1018	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216284064	2.39E-07	NA	mr1023	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216284064	8.36E-07	NA	mr1055	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216284064	2.71E-06	NA	mr1055	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216284064	2.71E-07	NA	mr1079	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216284064	3.55E-06	NA	mr1132	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216284064	2.85E-06	NA	mr1132	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216284064	7.17E-07	NA	mr1142	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216284064	1.83E-06	NA	mr1178	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216284064	1.83E-07	NA	mr1390	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216284064	NA	5.47E-09	mr1457	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216284064	2.14E-07	NA	mr1490	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216284064	3.59E-06	NA	mr1491	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216284064	NA	3.19E-08	mr1610	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216284064	1.69E-07	NA	mr1055_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216284064	2.76E-07	NA	mr1055_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216284064	9.15E-07	NA	mr1132_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216284064	8.44E-09	NA	mr1178_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216284064	1.46E-08	NA	mr1178_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216284064	4.33E-06	NA	mr1390_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216284064	3.64E-08	NA	mr1390_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216284064	3.74E-08	NA	mr1490_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251