\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1216284064:

Variant ID: vg1216284064 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 16284064
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:


GATTATCACCCCACGAAATCGATGTATTGTTAGAGGAGAGGCTGATATATTGGTTGTGCGACCGGGATAAGTAAATCGTCCGTCGGAGACTGGATAGGAG[G/A]
GTGTTCCCCAAGCAGTTGTTACTATTTTCGAGTTCCTGGGAGTTCATACCATGTTCTCAGGAATAATACACAAATGTCCCAATAGGAATCTCGTTTGTTG

Reverse complement sequence

CAACAAACGAGATTCCTATTGGGACATTTGTGTATTATTCCTGAGAACATGGTATGAACTCCCAGGAACTCGAAAATAGTAACAACTGCTTGGGGAACAC[C/T]
CTCCTATCCAGTCTCCGACGGACGATTTACTTATCCCGGTCGCACAACCAATATATCAGCCTCTCCTCTAACAATACATCGATTTCGTGGGGTGATAATC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 35.40% 34.40% 10.33% 19.89% NA
All Indica  2759 53.20% 13.00% 16.02% 17.83% NA
All Japonica  1512 12.00% 71.50% 1.72% 14.81% NA
Aus  269 1.50% 38.30% 1.86% 58.36% NA
Indica I  595 73.40% 5.40% 12.10% 9.08% NA
Indica II  465 58.90% 10.10% 16.34% 14.62% NA
Indica III  913 34.70% 18.70% 19.61% 26.94% NA
Indica Intermediate  786 55.90% 13.70% 14.63% 15.78% NA
Temperate Japonica  767 2.30% 97.50% 0.00% 0.13% NA
Tropical Japonica  504 27.60% 27.20% 4.37% 40.87% NA
Japonica Intermediate  241 10.00% 81.30% 1.66% 7.05% NA
VI/Aromatic  96 3.10% 44.80% 3.12% 48.96% NA
Intermediate  90 18.90% 45.60% 13.33% 22.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1216284064 G -> DEL N N silent_mutation Average:53.964; most accessible tissue: Zhenshan97 flower, score: 64.273 N N N N
vg1216284064 G -> A LOC_Os12g27650.1 downstream_gene_variant ; 4183.0bp to feature; MODIFIER silent_mutation Average:53.964; most accessible tissue: Zhenshan97 flower, score: 64.273 N N N N
vg1216284064 G -> A LOC_Os12g27650-LOC_Os12g27670 intergenic_region ; MODIFIER silent_mutation Average:53.964; most accessible tissue: Zhenshan97 flower, score: 64.273 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1216284064 2.50E-08 NA mr1016 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216284064 8.75E-06 NA mr1016 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216284064 1.48E-06 NA mr1017 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216284064 2.88E-06 NA mr1017 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216284064 2.20E-06 NA mr1018 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216284064 2.39E-07 NA mr1023 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216284064 8.36E-07 NA mr1055 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216284064 2.71E-06 NA mr1055 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216284064 2.71E-07 NA mr1079 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216284064 3.55E-06 NA mr1132 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216284064 2.85E-06 NA mr1132 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216284064 7.17E-07 NA mr1142 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216284064 1.83E-06 NA mr1178 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216284064 1.83E-07 NA mr1390 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216284064 NA 5.47E-09 mr1457 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216284064 2.14E-07 NA mr1490 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216284064 3.59E-06 NA mr1491 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216284064 NA 3.19E-08 mr1610 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216284064 1.69E-07 NA mr1055_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216284064 2.76E-07 NA mr1055_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216284064 9.15E-07 NA mr1132_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216284064 8.44E-09 NA mr1178_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216284064 1.46E-08 NA mr1178_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216284064 4.33E-06 NA mr1390_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216284064 3.64E-08 NA mr1390_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216284064 3.74E-08 NA mr1490_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251