\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1216283093:

Variant ID: vg1216283093 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 16283093
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.63, G: 0.38, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:


AAAAGACATTATTTTATTATATTATGGTCCCGTTCTTTTCTCTAGCAAGAGTTGGATGAAGATTAAGATTTTCGTGGTACGCTTTTCAAACTGTGTAAAC[A/G]
GTGCGTTTCATACAAAAAAAACTTTCTATATGAAAGTTGCTCTAAAATATCATATTAATCTATTTTTCAAGTTTGTAATAATTAAAACTCAATCAATCAT

Reverse complement sequence

ATGATTGATTGAGTTTTAATTATTACAAACTTGAAAAATAGATTAATATGATATTTTAGAGCAACTTTCATATAGAAAGTTTTTTTTGTATGAAACGCAC[T/C]
GTTTACACAGTTTGAAAAGCGTACCACGAAAATCTTAATCTTCATCCAACTCTTGCTAGAGAAAAGAACGGGACCATAATATAATAAAATAATGTCTTTT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 76.80% 7.00% 3.87% 12.38% NA
All Indica  2759 88.20% 2.90% 6.27% 2.61% NA
All Japonica  1512 66.90% 6.90% 0.40% 25.86% NA
Aus  269 32.30% 26.80% 1.12% 39.78% NA
Indica I  595 85.20% 0.00% 13.95% 0.84% NA
Indica II  465 93.30% 2.20% 2.58% 1.94% NA
Indica III  913 88.20% 4.90% 3.94% 2.96% NA
Indica Intermediate  786 87.50% 3.20% 5.34% 3.94% NA
Temperate Japonica  767 95.70% 2.30% 0.00% 1.96% NA
Tropical Japonica  504 18.70% 12.90% 1.19% 67.26% NA
Japonica Intermediate  241 75.90% 8.70% 0.00% 15.35% NA
VI/Aromatic  96 31.20% 63.50% 0.00% 5.21% NA
Intermediate  90 74.40% 13.30% 1.11% 11.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1216283093 A -> DEL N N silent_mutation Average:56.311; most accessible tissue: Minghui63 root, score: 75.155 N N N N
vg1216283093 A -> G LOC_Os12g27650.1 downstream_gene_variant ; 3212.0bp to feature; MODIFIER silent_mutation Average:56.311; most accessible tissue: Minghui63 root, score: 75.155 N N N N
vg1216283093 A -> G LOC_Os12g27650-LOC_Os12g27670 intergenic_region ; MODIFIER silent_mutation Average:56.311; most accessible tissue: Minghui63 root, score: 75.155 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1216283093 1.12E-08 2.54E-20 mr1016 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216283093 1.65E-08 5.45E-20 mr1017 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216283093 5.07E-11 3.39E-23 mr1018 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216283093 3.06E-06 1.10E-13 mr1019 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216283093 NA 4.71E-10 mr1022 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216283093 5.35E-07 8.25E-16 mr1023 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216283093 2.93E-10 5.52E-22 mr1055 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216283093 1.10E-06 6.16E-17 mr1079 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216283093 4.10E-10 1.18E-22 mr1132 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216283093 4.18E-07 6.40E-16 mr1142 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216283093 NA 1.64E-06 mr1156 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216283093 9.29E-06 6.90E-15 mr1178 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216283093 NA 4.59E-06 mr1330 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216283093 2.40E-09 9.09E-23 mr1390 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216283093 NA 3.15E-06 mr1438 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216283093 7.96E-06 NA mr1489 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216283093 5.06E-07 1.12E-16 mr1489 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216283093 2.15E-10 1.79E-24 mr1490 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216283093 7.86E-08 2.74E-17 mr1491 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216283093 NA 4.01E-06 mr1577 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216283093 1.55E-07 NA mr1778 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216283093 2.98E-06 1.56E-14 mr1778 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216283093 4.37E-07 NA mr1019_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216283093 2.92E-09 5.31E-18 mr1019_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216283093 NA 1.20E-13 mr1022_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216283093 1.67E-07 3.10E-19 mr1023_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216283093 2.42E-06 NA mr1055_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216283093 1.93E-13 1.78E-27 mr1055_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216283093 1.97E-08 2.28E-22 mr1079_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216283093 1.47E-06 NA mr1132_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216283093 2.78E-12 2.12E-28 mr1132_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216283093 1.31E-06 NA mr1178_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216283093 2.15E-15 7.39E-32 mr1178_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216283093 1.02E-07 5.05E-14 mr1261_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216283093 2.88E-07 NA mr1390_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216283093 7.59E-17 2.48E-34 mr1390_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216283093 2.10E-07 NA mr1489_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216283093 7.28E-08 4.54E-21 mr1489_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216283093 9.73E-07 NA mr1490_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216283093 2.92E-16 1.69E-33 mr1490_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216283093 2.24E-06 NA mr1778_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216283093 3.13E-06 4.01E-16 mr1778_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251