Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1216282971:

Variant ID: vg1216282971 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 16282971
Reference Allele: C	Alternative Allele: G
Primary Allele: G	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 100. )

Flanking Sequence (100 bp) in Reference Genome:

ATTAGCTATCGCATATAATACGACAGCCCGATATACATATGAGATTTGAGCCCAGAAGGAAAGCAACTCACACAAGTCCACAAATTGCCTTGTTGCGCTG[C/G]
TATGTATTCCTGCTTTACTCCAAAAGACATTATTTTATTATATTATGGTCCCGTTCTTTTCTCTAGCAAGAGTTGGATGAAGATTAAGATTTTCGTGGTA

Reverse complement sequence

TACCACGAAAATCTTAATCTTCATCCAACTCTTGCTAGAGAAAAGAACGGGACCATAATATAATAAAATAATGTCTTTTGGAGTAAAGCAGGAATACATA[G/C]
CAGCGCAACAAGGCAATTTGTGGACTTGTGTGAGTTGCTTTCCTTCTGGGCTCAAATCTCATATGTATATCGGGCTGTCGTATTATATGCGATAGCTAAT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	54.50%	31.70%	1.63%	12.15%	NA
All Indica	2759	89.30%	6.60%	1.78%	2.32%	NA
All Japonica	1512	2.60%	70.90%	0.66%	25.79%	NA
Aus	269	14.90%	40.10%	5.58%	39.41%	NA
Indica I	595	92.40%	2.50%	3.36%	1.68%	NA
Indica II	465	89.70%	6.20%	1.51%	2.58%	NA
Indica III	913	91.00%	6.70%	0.66%	1.64%	NA
Indica Intermediate	786	84.70%	9.80%	2.04%	3.44%	NA
Temperate Japonica	767	0.70%	97.40%	0.26%	1.69%	NA
Tropical Japonica	504	5.20%	25.60%	1.59%	67.66%	NA
Japonica Intermediate	241	3.70%	81.30%	0.00%	14.94%	NA
VI/Aromatic	96	1.00%	93.80%	0.00%	5.21%	NA
Intermediate	90	33.30%	53.30%	3.33%	10.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1216282971	C -> DEL	N	N	silent_mutation	Average:59.786; most accessible tissue: Minghui63 root, score: 75.485	N	N	N	N
vg1216282971	C -> G	LOC_Os12g27650.1	downstream_gene_variant ; 3090.0bp to feature; MODIFIER	silent_mutation	Average:59.786; most accessible tissue: Minghui63 root, score: 75.485	N	N	N	N
vg1216282971	C -> G	LOC_Os12g27650-LOC_Os12g27670	intergenic_region ; MODIFIER	silent_mutation	Average:59.786; most accessible tissue: Minghui63 root, score: 75.485	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1216282971	NA	5.88E-13	mr1016	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216282971	NA	3.11E-12	mr1017	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216282971	NA	4.78E-12	mr1055	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216282971	NA	3.83E-07	mr1071	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216282971	5.22E-06	5.75E-10	mr1132	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216282971	4.18E-06	NA	mr1178	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216282971	NA	5.74E-06	mr1304	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216282971	NA	5.29E-07	mr1443	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216282971	NA	2.48E-06	mr1622	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216282971	1.80E-06	NA	mr1055_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216282971	2.29E-07	7.99E-10	mr1071_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216282971	7.06E-07	2.74E-09	mr1080_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216282971	1.36E-07	4.02E-09	mr1203_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216282971	NA	3.83E-08	mr1489_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216282971	1.76E-08	7.72E-11	mr1613_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216282971	NA	2.62E-07	mr1619_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216282971	NA	6.23E-06	mr1815_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216282971	NA	1.36E-06	mr1925_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251