Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1216282887:

Variant ID: vg1216282887 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 16282887
Reference Allele: A	Alternative Allele: T
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CTACTAGACCCCGGTGGTCCAATGCCATTTTTCTGTTCAAGCTCAATTAGCAACTAAACAATACTAGTAAGTAGTAATTAGAAAATTAGCTATCGCATAT[A/T]
ATACGACAGCCCGATATACATATGAGATTTGAGCCCAGAAGGAAAGCAACTCACACAAGTCCACAAATTGCCTTGTTGCGCTGCTATGTATTCCTGCTTT

Reverse complement sequence

AAAGCAGGAATACATAGCAGCGCAACAAGGCAATTTGTGGACTTGTGTGAGTTGCTTTCCTTCTGGGCTCAAATCTCATATGTATATCGGGCTGTCGTAT[T/A]
ATATGCGATAGCTAATTTTCTAATTACTACTTACTAGTATTGTTTAGTTGCTAATTGAGCTTGAACAGAAAAATGGCATTGGACCACCGGGGTCTAGTAG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	56.20%	30.10%	1.97%	11.72%	NA
All Indica	2759	91.80%	5.00%	1.63%	1.49%	NA
All Japonica	1512	2.80%	70.10%	1.59%	25.46%	NA
Aus	269	16.70%	37.20%	5.58%	40.52%	NA
Indica I	595	95.80%	1.50%	2.52%	0.17%	NA
Indica II	465	92.50%	4.70%	0.65%	2.15%	NA
Indica III	913	92.90%	5.10%	0.44%	1.53%	NA
Indica Intermediate	786	87.30%	7.80%	2.93%	2.04%	NA
Temperate Japonica	767	0.70%	96.50%	0.65%	2.22%	NA
Tropical Japonica	504	5.80%	24.60%	3.37%	66.27%	NA
Japonica Intermediate	241	3.70%	81.30%	0.83%	14.11%	NA
VI/Aromatic	96	4.20%	87.50%	2.08%	6.25%	NA
Intermediate	90	34.40%	43.30%	7.78%	14.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1216282887	A -> DEL	N	N	silent_mutation	Average:63.194; most accessible tissue: Minghui63 root, score: 79.068	N	N	N	N
vg1216282887	A -> T	LOC_Os12g27650.1	downstream_gene_variant ; 3006.0bp to feature; MODIFIER	silent_mutation	Average:63.194; most accessible tissue: Minghui63 root, score: 79.068	N	N	N	N
vg1216282887	A -> T	LOC_Os12g27650-LOC_Os12g27670	intergenic_region ; MODIFIER	silent_mutation	Average:63.194; most accessible tissue: Minghui63 root, score: 79.068	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1216282887	1.58E-06	NA	mr1016	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216282887	4.55E-06	NA	mr1017	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216282887	9.96E-06	6.13E-11	mr1017	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216282887	3.23E-06	NA	mr1022	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216282887	3.58E-06	NA	mr1055	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216282887	NA	5.42E-07	mr1071	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216282887	NA	8.52E-06	mr1080	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216282887	NA	9.62E-06	mr1083	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216282887	1.28E-06	NA	mr1132	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216282887	NA	7.09E-08	mr1174	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216282887	5.61E-07	NA	mr1178	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216282887	NA	2.34E-06	mr1304	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216282887	NA	2.33E-07	mr1364	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216282887	NA	7.21E-15	mr1401	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216282887	NA	3.03E-07	mr1443	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216282887	NA	6.45E-07	mr1622	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216282887	NA	2.20E-10	mr1714	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216282887	3.22E-06	NA	mr1759	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216282887	2.45E-06	NA	mr1022_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216282887	3.83E-07	NA	mr1055_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216282887	1.93E-07	8.33E-10	mr1071_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216282887	3.93E-07	1.17E-09	mr1080_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216282887	1.30E-07	2.95E-09	mr1203_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216282887	1.11E-08	1.09E-10	mr1613_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216282887	NA	2.28E-07	mr1619_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216282887	NA	5.44E-06	mr1815_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251