\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1216282751:

Variant ID: vg1216282751 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 16282751
Reference Allele: GAlternative Allele: T
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 100. )

Flanking Sequence (100 bp) in Reference Genome:


GCGGTGCCCCCACACGCATCGAGCTAGACGCAGGTGCGAAGCTAGAGTTACTCATTGGGGTCAGTAGACCACGACGATTTTTTGCGAATATCTTGTACCA[G/T]
CACTAATTTACCGGCTATGACTCCAGTTAAGGAAACTACTAGACCCCGGTGGTCCAATGCCATTTTTCTGTTCAAGCTCAATTAGCAACTAAACAATACT

Reverse complement sequence

AGTATTGTTTAGTTGCTAATTGAGCTTGAACAGAAAAATGGCATTGGACCACCGGGGTCTAGTAGTTTCCTTAACTGGAGTCATAGCCGGTAAATTAGTG[C/A]
TGGTACAAGATATTCGCAAAAAATCGTCGTGGTCTACTGACCCCAATGAGTAACTCTAGCTTCGCACCTGCGTCTAGCTCGATGCGTGTGGGGGCACCGC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 39.30% 33.20% 8.70% 18.79% NA
All Indica  2759 64.00% 9.20% 13.74% 13.01% NA
All Japonica  1512 2.10% 70.70% 0.99% 26.19% NA
Aus  269 13.40% 40.10% 4.09% 42.38% NA
Indica I  595 49.20% 4.70% 23.70% 22.35% NA
Indica II  465 74.40% 10.50% 7.53% 7.53% NA
Indica III  913 73.30% 9.10% 8.32% 9.31% NA
Indica Intermediate  786 58.30% 12.10% 16.16% 13.49% NA
Temperate Japonica  767 0.40% 97.40% 0.52% 1.69% NA
Tropical Japonica  504 4.20% 24.80% 2.18% 68.85% NA
Japonica Intermediate  241 3.30% 81.70% 0.00% 14.94% NA
VI/Aromatic  96 1.00% 93.80% 0.00% 5.21% NA
Intermediate  90 23.30% 54.40% 6.67% 15.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1216282751 G -> DEL N N silent_mutation Average:58.675; most accessible tissue: Zhenshan97 flag leaf, score: 78.0 N N N N
vg1216282751 G -> T LOC_Os12g27650.1 downstream_gene_variant ; 2870.0bp to feature; MODIFIER silent_mutation Average:58.675; most accessible tissue: Zhenshan97 flag leaf, score: 78.0 N N N N
vg1216282751 G -> T LOC_Os12g27650-LOC_Os12g27670 intergenic_region ; MODIFIER silent_mutation Average:58.675; most accessible tissue: Zhenshan97 flag leaf, score: 78.0 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1216282751 NA 2.48E-06 mr1083 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216282751 8.14E-06 2.44E-06 mr1086 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216282751 1.19E-06 1.19E-06 mr1204 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216282751 9.18E-07 4.08E-06 mr1226 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216282751 2.01E-07 NA mr1411 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216282751 NA 6.32E-06 mr1949 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216282751 1.54E-07 1.54E-07 mr1076_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216282751 NA 2.34E-06 mr1082_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216282751 6.21E-06 6.17E-08 mr1083_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216282751 NA 6.97E-06 mr1103_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216282751 3.52E-06 2.06E-06 mr1104_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216282751 2.71E-06 9.53E-07 mr1226_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216282751 NA 7.24E-08 mr1498_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216282751 NA 6.02E-06 mr1498_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216282751 NA 1.20E-07 mr1613_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216282751 NA 4.65E-07 mr1619_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216282751 NA 3.25E-09 mr1925_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251