Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1216282751:

Variant ID: vg1216282751 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 16282751
Reference Allele: G	Alternative Allele: T
Primary Allele: T	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 100. )

Flanking Sequence (100 bp) in Reference Genome:

GCGGTGCCCCCACACGCATCGAGCTAGACGCAGGTGCGAAGCTAGAGTTACTCATTGGGGTCAGTAGACCACGACGATTTTTTGCGAATATCTTGTACCA[G/T]
CACTAATTTACCGGCTATGACTCCAGTTAAGGAAACTACTAGACCCCGGTGGTCCAATGCCATTTTTCTGTTCAAGCTCAATTAGCAACTAAACAATACT

Reverse complement sequence

AGTATTGTTTAGTTGCTAATTGAGCTTGAACAGAAAAATGGCATTGGACCACCGGGGTCTAGTAGTTTCCTTAACTGGAGTCATAGCCGGTAAATTAGTG[C/A]
TGGTACAAGATATTCGCAAAAAATCGTCGTGGTCTACTGACCCCAATGAGTAACTCTAGCTTCGCACCTGCGTCTAGCTCGATGCGTGTGGGGGCACCGC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	39.30%	33.20%	8.70%	18.79%	NA
All Indica	2759	64.00%	9.20%	13.74%	13.01%	NA
All Japonica	1512	2.10%	70.70%	0.99%	26.19%	NA
Aus	269	13.40%	40.10%	4.09%	42.38%	NA
Indica I	595	49.20%	4.70%	23.70%	22.35%	NA
Indica II	465	74.40%	10.50%	7.53%	7.53%	NA
Indica III	913	73.30%	9.10%	8.32%	9.31%	NA
Indica Intermediate	786	58.30%	12.10%	16.16%	13.49%	NA
Temperate Japonica	767	0.40%	97.40%	0.52%	1.69%	NA
Tropical Japonica	504	4.20%	24.80%	2.18%	68.85%	NA
Japonica Intermediate	241	3.30%	81.70%	0.00%	14.94%	NA
VI/Aromatic	96	1.00%	93.80%	0.00%	5.21%	NA
Intermediate	90	23.30%	54.40%	6.67%	15.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1216282751	G -> DEL	N	N	silent_mutation	Average:58.675; most accessible tissue: Zhenshan97 flag leaf, score: 78.0	N	N	N	N
vg1216282751	G -> T	LOC_Os12g27650.1	downstream_gene_variant ; 2870.0bp to feature; MODIFIER	silent_mutation	Average:58.675; most accessible tissue: Zhenshan97 flag leaf, score: 78.0	N	N	N	N
vg1216282751	G -> T	LOC_Os12g27650-LOC_Os12g27670	intergenic_region ; MODIFIER	silent_mutation	Average:58.675; most accessible tissue: Zhenshan97 flag leaf, score: 78.0	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1216282751	NA	2.48E-06	mr1083	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216282751	8.14E-06	2.44E-06	mr1086	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216282751	1.19E-06	1.19E-06	mr1204	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216282751	9.18E-07	4.08E-06	mr1226	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216282751	2.01E-07	NA	mr1411	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216282751	NA	6.32E-06	mr1949	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216282751	1.54E-07	1.54E-07	mr1076_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216282751	NA	2.34E-06	mr1082_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216282751	6.21E-06	6.17E-08	mr1083_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216282751	NA	6.97E-06	mr1103_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216282751	3.52E-06	2.06E-06	mr1104_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216282751	2.71E-06	9.53E-07	mr1226_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216282751	NA	7.24E-08	mr1498_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216282751	NA	6.02E-06	mr1498_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216282751	NA	1.20E-07	mr1613_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216282751	NA	4.65E-07	mr1619_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216282751	NA	3.25E-09	mr1925_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251