\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1216282575:

Variant ID: vg1216282575 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 16282575
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 97. )

Flanking Sequence (100 bp) in Reference Genome:


CACGGCGCATGGCGGCGGTGGCCTCCTACGCGAGGAGACAAATGGCAGCGGCAGTGCACGGTGTGGCGCGGCTGCTATGCGGTGTGGAGGCACACAGTGC[T/C]
GGTGGCTTCCTCGGGTGGACGCAGCCACCTCTGCGTGGAGGCGGATGGCAGCAGCGATGGGACCAGGTGGCGGTGGCGGTGCCCCCACACGCATCGAGCT

Reverse complement sequence

AGCTCGATGCGTGTGGGGGCACCGCCACCGCCACCTGGTCCCATCGCTGCTGCCATCCGCCTCCACGCAGAGGTGGCTGCGTCCACCCGAGGAAGCCACC[A/G]
GCACTGTGTGCCTCCACACCGCATAGCAGCCGCGCCACACCGTGCACTGCCGCTGCCATTTGTCTCCTCGCGTAGGAGGCCACCGCCGCCATGCGCCGTG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 31.30% 2.20% 0.63% 65.87% NA
All Indica  2759 6.20% 3.70% 0.69% 89.49% NA
All Japonica  1512 70.80% 0.10% 0.40% 28.70% NA
Aus  269 38.30% 0.00% 0.37% 61.34% NA
Indica I  595 2.20% 0.20% 0.34% 97.31% NA
Indica II  465 5.60% 17.80% 0.43% 76.13% NA
Indica III  913 6.00% 0.20% 1.10% 92.66% NA
Indica Intermediate  786 9.70% 1.90% 0.64% 87.79% NA
Temperate Japonica  767 97.40% 0.00% 0.00% 2.61% NA
Tropical Japonica  504 25.40% 0.00% 1.19% 73.41% NA
Japonica Intermediate  241 81.30% 0.40% 0.00% 18.26% NA
VI/Aromatic  96 91.70% 0.00% 0.00% 8.33% NA
Intermediate  90 54.40% 0.00% 4.44% 41.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1216282575 T -> C LOC_Os12g27650.1 downstream_gene_variant ; 2694.0bp to feature; MODIFIER silent_mutation Average:45.637; most accessible tissue: Zhenshan97 flag leaf, score: 82.874 N N N N
vg1216282575 T -> C LOC_Os12g27650-LOC_Os12g27670 intergenic_region ; MODIFIER silent_mutation Average:45.637; most accessible tissue: Zhenshan97 flag leaf, score: 82.874 N N N N
vg1216282575 T -> DEL N N silent_mutation Average:45.637; most accessible tissue: Zhenshan97 flag leaf, score: 82.874 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1216282575 T C -0.07 -0.04 -0.03 -0.08 -0.08 -0.06

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1216282575 5.48E-06 1.07E-10 mr1017 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216282575 2.16E-06 NA mr1055 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216282575 NA 1.64E-06 mr1071 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216282575 6.24E-07 NA mr1178 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216282575 NA 2.33E-06 mr1304 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216282575 NA 3.71E-06 mr1364 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216282575 NA 5.44E-07 mr1443 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216282575 NA 1.29E-06 mr1443 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216282575 4.51E-06 NA mr1485 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216282575 NA 8.91E-06 mr1613 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216282575 NA 5.57E-07 mr1622 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216282575 NA 1.18E-06 mr1696 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216282575 NA 8.46E-11 mr1714 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216282575 8.20E-07 NA mr1759 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216282575 6.42E-07 NA mr1055_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216282575 8.88E-07 NA mr1071_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216282575 2.83E-06 1.64E-08 mr1080_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216282575 1.30E-06 2.66E-08 mr1203_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216282575 9.25E-06 NA mr1390_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216282575 8.99E-07 4.19E-09 mr1613_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216282575 NA 3.26E-07 mr1619_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216282575 NA 2.81E-06 mr1815_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251