\
| Variant ID: vg1216282324 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 16282324 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TGGGAGTCCACAAGTGGGCCAATCAAAACTCGCTACCCCTCCCAGGGCCCGTGCTGGAACGGTGTGTGTGAAAATGTGAATTACCAGTGCAACAACGGTG[T/C]
GTGTAAAAATGTTATAAAGCACATAATCAGTATTCGGCAAACCCACATTATCGCCACAAACAACAATCTTATTCGTGAAACAGTCGACGGTACAAGCAAA
TTTGCTTGTACCGTCGACTGTTTCACGAATAAGATTGTTGTTTGTGGCGATAATGTGGGTTTGCCGAATACTGATTATGTGCTTTATAACATTTTTACAC[A/G]
CACCGTTGTTGCACTGGTAATTCACATTTTCACACACACCGTTCCAGCACGGGCCCTGGGAGGGGTAGCGAGTTTTGATTGGCCCACTTGTGGACTCCCA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 48.80% | 40.60% | 0.19% | 10.41% | NA |
| All Indica | 2759 | 73.80% | 21.40% | 0.18% | 4.68% | NA |
| All Japonica | 1512 | 15.20% | 71.10% | 0.20% | 13.49% | NA |
| Aus | 269 | 3.70% | 40.10% | 0.37% | 55.76% | NA |
| Indica I | 595 | 87.10% | 9.20% | 0.17% | 3.53% | NA |
| Indica II | 465 | 65.40% | 24.50% | 0.00% | 10.11% | NA |
| Indica III | 913 | 71.70% | 25.50% | 0.11% | 2.63% | NA |
| Indica Intermediate | 786 | 71.00% | 23.90% | 0.38% | 4.71% | NA |
| Temperate Japonica | 767 | 2.20% | 97.50% | 0.00% | 0.26% | NA |
| Tropical Japonica | 504 | 36.30% | 25.80% | 0.60% | 37.30% | NA |
| Japonica Intermediate | 241 | 12.40% | 81.70% | 0.00% | 5.81% | NA |
| VI/Aromatic | 96 | 6.20% | 92.70% | 0.00% | 1.04% | NA |
| Intermediate | 90 | 30.00% | 61.10% | 0.00% | 8.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1216282324 | T -> C | LOC_Os12g27650.1 | downstream_gene_variant ; 2443.0bp to feature; MODIFIER | silent_mutation | Average:30.253; most accessible tissue: Zhenshan97 flag leaf, score: 69.147 | N | N | N | N |
| vg1216282324 | T -> C | LOC_Os12g27650-LOC_Os12g27670 | intergenic_region ; MODIFIER | silent_mutation | Average:30.253; most accessible tissue: Zhenshan97 flag leaf, score: 69.147 | N | N | N | N |
| vg1216282324 | T -> DEL | N | N | silent_mutation | Average:30.253; most accessible tissue: Zhenshan97 flag leaf, score: 69.147 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1216282324 | NA | 8.13E-06 | mr1106 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216282324 | 2.54E-06 | 1.46E-07 | mr1268 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216282324 | NA | 1.53E-06 | mr1304 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216282324 | NA | 7.43E-08 | mr1364 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216282324 | NA | 8.46E-06 | mr1364 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216282324 | NA | 2.29E-07 | mr1443 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216282324 | 5.34E-06 | NA | mr1485 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216282324 | NA | 2.65E-06 | mr1622 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216282324 | NA | 9.81E-06 | mr1884 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216282324 | NA | 6.34E-07 | mr1047_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216282324 | NA | 3.22E-06 | mr1227_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216282324 | NA | 2.13E-06 | mr1815_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |