\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1216281909:

Variant ID: vg1216281909 (JBrowse)Variation Type: INDEL
Chromosome: chr12Position: 16281909
Reference Allele: AAlternative Allele: AC,G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACTGCTGTCATCATTGCTTTAACCTTGTGTTGAGGGTTGGCGTCATATAGTGGTCAGGTACAGTATCCAACACGGTACCAAAAGGGGTGACTGCAGCAAC[A/AC,G]
GCATTTTGTTCTGGCGTGACGAAGACGTTGTGGTTATCATGGCGCGTCTGGATGATGTTGTTGTGAACCGAGCGCCCTTGACTAGCTAGATCACGTTGGT

Reverse complement sequence

ACCAACGTGATCTAGCTAGTCAAGGGCGCTCGGTTCACAACAACATCATCCAGACGCGCCATGATAACCACAACGTCTTCGTCACGCCAGAACAAAATGC[T/GT,C]
GTTGCTGCAGTCACCCCTTTTGGTACCGTGTTGGATACTGTACCTGACCACTATATGACGCCAACCCTCAACACAAGGTTAAAGCAATGATGACAGCAGT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 23.00% 9.20% 3.70% 62.59% AC: 1.44%
All Indica  2759 3.30% 4.40% 5.98% 83.98% AC: 2.36%
All Japonica  1512 59.90% 11.20% 0.20% 28.64% AC: 0.13%
Aus  269 11.90% 26.80% 1.86% 59.48% NA
Indica I  595 3.00% 0.00% 10.42% 84.87% AC: 1.68%
Indica II  465 4.30% 6.70% 6.67% 78.92% AC: 3.44%
Indica III  913 1.20% 5.90% 1.75% 88.83% AC: 2.30%
Indica Intermediate  786 5.30% 4.60% 7.12% 80.66% AC: 2.29%
Temperate Japonica  767 89.20% 8.20% 0.13% 2.35% AC: 0.13%
Tropical Japonica  504 12.30% 13.70% 0.40% 73.41% AC: 0.20%
Japonica Intermediate  241 66.00% 15.40% 0.00% 18.67% NA
VI/Aromatic  96 28.10% 63.50% 0.00% 8.33% NA
Intermediate  90 37.80% 14.40% 2.22% 44.44% AC: 1.11%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1216281909 A -> DEL N N silent_mutation Average:18.724; most accessible tissue: Zhenshan97 flag leaf, score: 52.255 N N N N
vg1216281909 A -> G LOC_Os12g27650.1 downstream_gene_variant ; 2028.0bp to feature; MODIFIER silent_mutation Average:18.724; most accessible tissue: Zhenshan97 flag leaf, score: 52.255 N N N N
vg1216281909 A -> G LOC_Os12g27650-LOC_Os12g27670 intergenic_region ; MODIFIER silent_mutation Average:18.724; most accessible tissue: Zhenshan97 flag leaf, score: 52.255 N N N N
vg1216281909 A -> AC LOC_Os12g27650.1 downstream_gene_variant ; 2029.0bp to feature; MODIFIER silent_mutation Average:18.724; most accessible tissue: Zhenshan97 flag leaf, score: 52.255 N N N N
vg1216281909 A -> AC LOC_Os12g27650-LOC_Os12g27670 intergenic_region ; MODIFIER silent_mutation Average:18.724; most accessible tissue: Zhenshan97 flag leaf, score: 52.255 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1216281909 NA 1.06E-07 mr1022 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216281909 8.93E-07 NA mr1489 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216281909 6.05E-06 NA mr1491 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216281909 7.98E-09 NA mr1778 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216281909 NA 2.45E-07 mr1805 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216281909 NA 5.18E-10 mr1022_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216281909 NA 3.56E-07 mr1057_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216281909 6.41E-07 7.87E-15 mr1079_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216281909 1.12E-10 NA mr1489_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216281909 3.35E-06 1.71E-15 mr1489_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216281909 1.09E-11 NA mr1778_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216281909 NA 4.88E-14 mr1778_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251