\
| Variant ID: vg1216281909 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr12 | Position: 16281909 |
| Reference Allele: A | Alternative Allele: AC,G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
ACTGCTGTCATCATTGCTTTAACCTTGTGTTGAGGGTTGGCGTCATATAGTGGTCAGGTACAGTATCCAACACGGTACCAAAAGGGGTGACTGCAGCAAC[A/AC,G]
GCATTTTGTTCTGGCGTGACGAAGACGTTGTGGTTATCATGGCGCGTCTGGATGATGTTGTTGTGAACCGAGCGCCCTTGACTAGCTAGATCACGTTGGT
ACCAACGTGATCTAGCTAGTCAAGGGCGCTCGGTTCACAACAACATCATCCAGACGCGCCATGATAACCACAACGTCTTCGTCACGCCAGAACAAAATGC[T/GT,C]
GTTGCTGCAGTCACCCCTTTTGGTACCGTGTTGGATACTGTACCTGACCACTATATGACGCCAACCCTCAACACAAGGTTAAAGCAATGATGACAGCAGT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 23.00% | 9.20% | 3.70% | 62.59% | AC: 1.44% |
| All Indica | 2759 | 3.30% | 4.40% | 5.98% | 83.98% | AC: 2.36% |
| All Japonica | 1512 | 59.90% | 11.20% | 0.20% | 28.64% | AC: 0.13% |
| Aus | 269 | 11.90% | 26.80% | 1.86% | 59.48% | NA |
| Indica I | 595 | 3.00% | 0.00% | 10.42% | 84.87% | AC: 1.68% |
| Indica II | 465 | 4.30% | 6.70% | 6.67% | 78.92% | AC: 3.44% |
| Indica III | 913 | 1.20% | 5.90% | 1.75% | 88.83% | AC: 2.30% |
| Indica Intermediate | 786 | 5.30% | 4.60% | 7.12% | 80.66% | AC: 2.29% |
| Temperate Japonica | 767 | 89.20% | 8.20% | 0.13% | 2.35% | AC: 0.13% |
| Tropical Japonica | 504 | 12.30% | 13.70% | 0.40% | 73.41% | AC: 0.20% |
| Japonica Intermediate | 241 | 66.00% | 15.40% | 0.00% | 18.67% | NA |
| VI/Aromatic | 96 | 28.10% | 63.50% | 0.00% | 8.33% | NA |
| Intermediate | 90 | 37.80% | 14.40% | 2.22% | 44.44% | AC: 1.11% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1216281909 | A -> DEL | N | N | silent_mutation | Average:18.724; most accessible tissue: Zhenshan97 flag leaf, score: 52.255 | N | N | N | N |
| vg1216281909 | A -> G | LOC_Os12g27650.1 | downstream_gene_variant ; 2028.0bp to feature; MODIFIER | silent_mutation | Average:18.724; most accessible tissue: Zhenshan97 flag leaf, score: 52.255 | N | N | N | N |
| vg1216281909 | A -> G | LOC_Os12g27650-LOC_Os12g27670 | intergenic_region ; MODIFIER | silent_mutation | Average:18.724; most accessible tissue: Zhenshan97 flag leaf, score: 52.255 | N | N | N | N |
| vg1216281909 | A -> AC | LOC_Os12g27650.1 | downstream_gene_variant ; 2029.0bp to feature; MODIFIER | silent_mutation | Average:18.724; most accessible tissue: Zhenshan97 flag leaf, score: 52.255 | N | N | N | N |
| vg1216281909 | A -> AC | LOC_Os12g27650-LOC_Os12g27670 | intergenic_region ; MODIFIER | silent_mutation | Average:18.724; most accessible tissue: Zhenshan97 flag leaf, score: 52.255 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1216281909 | NA | 1.06E-07 | mr1022 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216281909 | 8.93E-07 | NA | mr1489 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216281909 | 6.05E-06 | NA | mr1491 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216281909 | 7.98E-09 | NA | mr1778 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216281909 | NA | 2.45E-07 | mr1805 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216281909 | NA | 5.18E-10 | mr1022_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216281909 | NA | 3.56E-07 | mr1057_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216281909 | 6.41E-07 | 7.87E-15 | mr1079_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216281909 | 1.12E-10 | NA | mr1489_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216281909 | 3.35E-06 | 1.71E-15 | mr1489_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216281909 | 1.09E-11 | NA | mr1778_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216281909 | NA | 4.88E-14 | mr1778_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |