Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1216279541:

Variant ID: vg1216279541 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 16279541
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:

TGCATTGAAGTTAAGCAGATCTCCCAGGCCATCGTGTTTTCACATCAACAACCACCTAGGAGTGCTTACTCATGCCCCCAAGGTTTGGAGAGGTACAGGT[T/C]
GATCTGCAGAGTCATAGGGTGCGAGAACTTCTCAATTCTTGTGGATGACATCAAACTAGTGCTGGAAGCCGAGAAGAACACTACTTGGCTAAAGTTCAAG

Reverse complement sequence

CTTGAACTTTAGCCAAGTAGTGTTCTTCTCGGCTTCCAGCACTAGTTTGATGTCATCCACAAGAATTGAGAAGTTCTCGCACCCTATGACTCTGCAGATC[A/G]
ACCTGTACCTCTCCAAACCTTGGGGGCATGAGTAAGCACTCCTAGGTGGTTGTTGATGTGAAAACACGATGGCCTGGGAGATCTGCTTAACTTCAATGCA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	47.50%	41.80%	0.28%	10.41%	NA
All Indica	2759	33.20%	61.80%	0.29%	4.68%	NA
All Japonica	1512	71.40%	15.30%	0.20%	13.10%	NA
Aus	269	38.70%	3.00%	0.37%	57.99%	NA
Indica I	595	13.90%	82.20%	0.00%	3.87%	NA
Indica II	465	29.50%	60.40%	1.08%	9.03%	NA
Indica III	913	50.30%	46.80%	0.11%	2.85%	NA
Indica Intermediate	786	30.30%	64.60%	0.25%	4.83%	NA
Temperate Japonica	767	97.40%	2.30%	0.00%	0.26%	NA
Tropical Japonica	504	26.80%	36.50%	0.60%	36.11%	NA
Japonica Intermediate	241	82.20%	12.00%	0.00%	5.81%	NA
VI/Aromatic	96	93.80%	5.20%	0.00%	1.04%	NA
Intermediate	90	62.20%	27.80%	1.11%	8.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1216279541	T -> C	LOC_Os12g27650.1	missense_variant ; p.Leu52Ser; MODERATE	nonsynonymous_codon ; L52S	Average:29.099; most accessible tissue: Zhenshan97 flag leaf, score: 68.25	unknown	unknown	TOLERATED	0.58
vg1216279541	T -> DEL	LOC_Os12g27650.1	N	frameshift_variant	Average:29.099; most accessible tissue: Zhenshan97 flag leaf, score: 68.25	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1216279541	6.29E-08	NA	mr1016	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216279541	1.06E-08	9.99E-11	mr1017	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216279541	4.39E-08	3.93E-12	mr1022	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216279541	1.80E-07	NA	mr1055	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216279541	3.34E-06	NA	mr1079	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216279541	5.19E-06	NA	mr1132	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216279541	3.51E-06	NA	mr1178	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216279541	NA	3.81E-06	mr1268	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216279541	NA	2.71E-06	mr1304	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216279541	NA	1.45E-07	mr1364	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216279541	NA	9.86E-06	mr1364	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216279541	1.54E-07	2.47E-11	mr1390	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216279541	NA	4.26E-07	mr1443	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216279541	NA	2.60E-06	mr1443	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216279541	2.94E-07	9.02E-12	mr1490	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216279541	NA	3.17E-12	mr1667	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216279541	NA	1.88E-07	mr1696	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216279541	7.16E-10	3.04E-14	mr1022_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216279541	1.12E-07	5.02E-10	mr1023_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216279541	5.72E-10	1.85E-14	mr1055_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216279541	2.18E-10	4.03E-14	mr1079_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216279541	9.07E-10	4.07E-13	mr1132_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216279541	NA	2.71E-16	mr1133_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216279541	7.88E-06	NA	mr1178_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216279541	1.18E-09	3.70E-14	mr1178_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216279541	NA	1.11E-06	mr1227_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216279541	8.16E-10	4.57E-15	mr1390_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216279541	5.06E-07	4.61E-09	mr1489_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216279541	7.92E-06	NA	mr1490_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216279541	8.71E-11	3.59E-15	mr1490_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216279541	NA	7.96E-11	mr1667_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251