| Variant ID: vg1216278958 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 16278958 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
TTCTTTTCAAACTTTGAGATGCATCATCCCTAGTCGTGCTTAGAACCATGCAAACTAGCCTGCAATTAGGCATAATAAGGATAGTATCGGGGTTTTAGCC[A/G]
ATCTTACCTAATATACATGTTTCACTCCATGTTTCATGTATATTCGCCACTTATATAGATAGATCATTTTATATAAGCATATCAAGCTTTAGTCAATATC
GATATTGACTAAAGCTTGATATGCTTATATAAAATGATCTATCTATATAAGTGGCGAATATACATGAAACATGGAGTGAAACATGTATATTAGGTAAGAT[T/C]
GGCTAAAACCCCGATACTATCCTTATTATGCCTAATTGCAGGCTAGTTTGCATGGTTCTAAGCACGACTAGGGATGATGCATCTCAAAGTTTGAAAAGAA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 95.10% | 0.30% | 0.28% | 4.36% | NA |
| All Indica | 2759 | 99.10% | 0.10% | 0.14% | 0.65% | NA |
| All Japonica | 1512 | 89.90% | 0.50% | 0.46% | 9.19% | NA |
| Aus | 269 | 81.80% | 1.10% | 0.74% | 16.36% | NA |
| Indica I | 595 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 96.10% | 0.20% | 0.86% | 2.80% | NA |
| Indica III | 913 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.40% | 0.00% | 0.00% | 0.64% | NA |
| Temperate Japonica | 767 | 99.90% | 0.00% | 0.00% | 0.13% | NA |
| Tropical Japonica | 504 | 72.00% | 1.20% | 1.39% | 25.40% | NA |
| Japonica Intermediate | 241 | 95.40% | 0.40% | 0.00% | 4.15% | NA |
| VI/Aromatic | 96 | 99.00% | 0.00% | 0.00% | 1.04% | NA |
| Intermediate | 90 | 95.60% | 0.00% | 0.00% | 4.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1216278958 | A -> DEL | N | N | silent_mutation | Average:27.306; most accessible tissue: Zhenshan97 flag leaf, score: 56.01 | N | N | N | N |
| vg1216278958 | A -> G | LOC_Os12g27640.1 | upstream_gene_variant ; 3479.0bp to feature; MODIFIER | silent_mutation | Average:27.306; most accessible tissue: Zhenshan97 flag leaf, score: 56.01 | N | N | N | N |
| vg1216278958 | A -> G | LOC_Os12g27650.1 | intron_variant ; MODIFIER | silent_mutation | Average:27.306; most accessible tissue: Zhenshan97 flag leaf, score: 56.01 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1216278958 | 5.26E-06 | NA | mr1016 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216278958 | 1.27E-07 | NA | mr1390 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216278958 | 8.74E-07 | NA | mr1390 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216278958 | 8.96E-08 | NA | mr1490 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216278958 | 2.45E-07 | NA | mr1490 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216278958 | 7.68E-06 | NA | mr1079_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216278958 | 2.92E-06 | NA | mr1390_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216278958 | 9.23E-06 | NA | mr1490_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216278958 | 2.07E-06 | NA | mr1490_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |