\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1216278958:

Variant ID: vg1216278958 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 16278958
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTCTTTTCAAACTTTGAGATGCATCATCCCTAGTCGTGCTTAGAACCATGCAAACTAGCCTGCAATTAGGCATAATAAGGATAGTATCGGGGTTTTAGCC[A/G]
ATCTTACCTAATATACATGTTTCACTCCATGTTTCATGTATATTCGCCACTTATATAGATAGATCATTTTATATAAGCATATCAAGCTTTAGTCAATATC

Reverse complement sequence

GATATTGACTAAAGCTTGATATGCTTATATAAAATGATCTATCTATATAAGTGGCGAATATACATGAAACATGGAGTGAAACATGTATATTAGGTAAGAT[T/C]
GGCTAAAACCCCGATACTATCCTTATTATGCCTAATTGCAGGCTAGTTTGCATGGTTCTAAGCACGACTAGGGATGATGCATCTCAAAGTTTGAAAAGAA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 95.10% 0.30% 0.28% 4.36% NA
All Indica  2759 99.10% 0.10% 0.14% 0.65% NA
All Japonica  1512 89.90% 0.50% 0.46% 9.19% NA
Aus  269 81.80% 1.10% 0.74% 16.36% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 96.10% 0.20% 0.86% 2.80% NA
Indica III  913 99.80% 0.20% 0.00% 0.00% NA
Indica Intermediate  786 99.40% 0.00% 0.00% 0.64% NA
Temperate Japonica  767 99.90% 0.00% 0.00% 0.13% NA
Tropical Japonica  504 72.00% 1.20% 1.39% 25.40% NA
Japonica Intermediate  241 95.40% 0.40% 0.00% 4.15% NA
VI/Aromatic  96 99.00% 0.00% 0.00% 1.04% NA
Intermediate  90 95.60% 0.00% 0.00% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1216278958 A -> DEL N N silent_mutation Average:27.306; most accessible tissue: Zhenshan97 flag leaf, score: 56.01 N N N N
vg1216278958 A -> G LOC_Os12g27640.1 upstream_gene_variant ; 3479.0bp to feature; MODIFIER silent_mutation Average:27.306; most accessible tissue: Zhenshan97 flag leaf, score: 56.01 N N N N
vg1216278958 A -> G LOC_Os12g27650.1 intron_variant ; MODIFIER silent_mutation Average:27.306; most accessible tissue: Zhenshan97 flag leaf, score: 56.01 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1216278958 5.26E-06 NA mr1016 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216278958 1.27E-07 NA mr1390 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216278958 8.74E-07 NA mr1390 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216278958 8.96E-08 NA mr1490 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216278958 2.45E-07 NA mr1490 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216278958 7.68E-06 NA mr1079_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216278958 2.92E-06 NA mr1390_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216278958 9.23E-06 NA mr1490_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216278958 2.07E-06 NA mr1490_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251