Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1216278958:

Variant ID: vg1216278958 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 16278958
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTCTTTTCAAACTTTGAGATGCATCATCCCTAGTCGTGCTTAGAACCATGCAAACTAGCCTGCAATTAGGCATAATAAGGATAGTATCGGGGTTTTAGCC[A/G]
ATCTTACCTAATATACATGTTTCACTCCATGTTTCATGTATATTCGCCACTTATATAGATAGATCATTTTATATAAGCATATCAAGCTTTAGTCAATATC

Reverse complement sequence

GATATTGACTAAAGCTTGATATGCTTATATAAAATGATCTATCTATATAAGTGGCGAATATACATGAAACATGGAGTGAAACATGTATATTAGGTAAGAT[T/C]
GGCTAAAACCCCGATACTATCCTTATTATGCCTAATTGCAGGCTAGTTTGCATGGTTCTAAGCACGACTAGGGATGATGCATCTCAAAGTTTGAAAAGAA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	95.10%	0.30%	0.28%	4.36%	NA
All Indica	2759	99.10%	0.10%	0.14%	0.65%	NA
All Japonica	1512	89.90%	0.50%	0.46%	9.19%	NA
Aus	269	81.80%	1.10%	0.74%	16.36%	NA
Indica I	595	99.80%	0.20%	0.00%	0.00%	NA
Indica II	465	96.10%	0.20%	0.86%	2.80%	NA
Indica III	913	99.80%	0.20%	0.00%	0.00%	NA
Indica Intermediate	786	99.40%	0.00%	0.00%	0.64%	NA
Temperate Japonica	767	99.90%	0.00%	0.00%	0.13%	NA
Tropical Japonica	504	72.00%	1.20%	1.39%	25.40%	NA
Japonica Intermediate	241	95.40%	0.40%	0.00%	4.15%	NA
VI/Aromatic	96	99.00%	0.00%	0.00%	1.04%	NA
Intermediate	90	95.60%	0.00%	0.00%	4.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1216278958	A -> DEL	N	N	silent_mutation	Average:27.306; most accessible tissue: Zhenshan97 flag leaf, score: 56.01	N	N	N	N
vg1216278958	A -> G	LOC_Os12g27640.1	upstream_gene_variant ; 3479.0bp to feature; MODIFIER	silent_mutation	Average:27.306; most accessible tissue: Zhenshan97 flag leaf, score: 56.01	N	N	N	N
vg1216278958	A -> G	LOC_Os12g27650.1	intron_variant ; MODIFIER	silent_mutation	Average:27.306; most accessible tissue: Zhenshan97 flag leaf, score: 56.01	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1216278958	5.26E-06	NA	mr1016	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216278958	1.27E-07	NA	mr1390	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216278958	8.74E-07	NA	mr1390	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216278958	8.96E-08	NA	mr1490	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216278958	2.45E-07	NA	mr1490	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216278958	7.68E-06	NA	mr1079_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216278958	2.92E-06	NA	mr1390_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216278958	9.23E-06	NA	mr1490_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216278958	2.07E-06	NA	mr1490_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251