\
| Variant ID: vg1216278647 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 16278647 |
| Reference Allele: G | Alternative Allele: T |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
CAACTTCGGCGCATCGCCACCCTTTTACTTTTCTCATTTTCCGGCGAGTTCTTCGCAAGAGGTAACCCATCTCAACGGCCCGCGCTATCGGGGCTAACAT[G/T]
TCGCTTTAGACGTGTTAGGCTCGATATCGCGAGTCATTCCTATCGTATGTCTTAGTTAATCTATCCTTAGCTTCCCAATTTAGCTCTATCTGCTGCTGCT
AGCAGCAGCAGATAGAGCTAAATTGGGAAGCTAAGGATAGATTAACTAAGACATACGATAGGAATGACTCGCGATATCGAGCCTAACACGTCTAAAGCGA[C/A]
ATGTTAGCCCCGATAGCGCGGGCCGTTGAGATGGGTTACCTCTTGCGAAGAACTCGCCGGAAAATGAGAAAAGTAAAAGGGTGGCGATGCGCCGAAGTTG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 97.20% | 2.20% | 0.13% | 0.47% | NA |
| All Indica | 2759 | 99.80% | 0.10% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 92.40% | 6.20% | 0.13% | 1.26% | NA |
| Aus | 269 | 97.80% | 0.00% | 1.12% | 1.12% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.70% | 0.10% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 97.50% | 2.30% | 0.00% | 0.13% | NA |
| Tropical Japonica | 504 | 84.10% | 12.10% | 0.40% | 3.37% | NA |
| Japonica Intermediate | 241 | 93.40% | 6.20% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 93.30% | 6.70% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1216278647 | G -> DEL | N | N | silent_mutation | Average:22.892; most accessible tissue: Zhenshan97 flower, score: 36.732 | N | N | N | N |
| vg1216278647 | G -> T | LOC_Os12g27640.1 | upstream_gene_variant ; 3168.0bp to feature; MODIFIER | silent_mutation | Average:22.892; most accessible tissue: Zhenshan97 flower, score: 36.732 | N | N | N | N |
| vg1216278647 | G -> T | LOC_Os12g27650.1 | intron_variant ; MODIFIER | silent_mutation | Average:22.892; most accessible tissue: Zhenshan97 flower, score: 36.732 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1216278647 | NA | 4.12E-08 | mr1790 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216278647 | NA | 4.35E-07 | mr1805 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216278647 | NA | 6.05E-12 | mr1055_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216278647 | 8.82E-06 | 2.04E-14 | mr1390_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216278647 | NA | 8.76E-14 | mr1490_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |