\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1216278472:

Variant ID: vg1216278472 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 16278472
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 100. )

Flanking Sequence (100 bp) in Reference Genome:


TTATATCTATTAATTAGGAATTGAGTCGGTTTGTTAGAGATTTGGTAAGGGGCCATCGTATATGTCTGTATCTTAATTATAGAAAGGTTTGAGCCATGTC[C/T]
ATAATGGACTGAGTTTGTACTTGGGGATATAAATATGAACCCCATAGCATTGAAATAAGGGATCCAATCTAACACAACTTCGGCGCATCGCCACCCTTTT

Reverse complement sequence

AAAAGGGTGGCGATGCGCCGAAGTTGTGTTAGATTGGATCCCTTATTTCAATGCTATGGGGTTCATATTTATATCCCCAAGTACAAACTCAGTCCATTAT[G/A]
GACATGGCTCAAACCTTTCTATAATTAAGATACAGACATATACGATGGCCCCTTACCAAATCTCTAACAAACCGACTCAATTCCTAATTAATAGATATAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 36.40% 16.70% 28.16% 18.75% NA
All Indica  2759 14.40% 20.80% 46.14% 18.67% NA
All Japonica  1512 71.30% 13.40% 1.65% 13.69% NA
Aus  269 38.30% 0.70% 4.09% 56.88% NA
Indica I  595 9.20% 23.00% 39.50% 28.24% NA
Indica II  465 24.30% 35.10% 19.35% 21.29% NA
Indica III  913 11.10% 9.40% 68.78% 10.73% NA
Indica Intermediate  786 16.40% 23.80% 40.71% 19.08% NA
Temperate Japonica  767 97.50% 1.60% 0.39% 0.52% NA
Tropical Japonica  504 26.20% 33.10% 2.98% 37.70% NA
Japonica Intermediate  241 82.20% 9.50% 2.90% 5.39% NA
VI/Aromatic  96 92.70% 2.10% 4.17% 1.04% NA
Intermediate  90 60.00% 8.90% 20.00% 11.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1216278472 C -> DEL N N silent_mutation Average:22.977; most accessible tissue: Callus, score: 48.289 N N N N
vg1216278472 C -> T LOC_Os12g27640.1 upstream_gene_variant ; 2993.0bp to feature; MODIFIER silent_mutation Average:22.977; most accessible tissue: Callus, score: 48.289 N N N N
vg1216278472 C -> T LOC_Os12g27650.1 intron_variant ; MODIFIER silent_mutation Average:22.977; most accessible tissue: Callus, score: 48.289 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1216278472 3.89E-06 1.30E-11 mr1016 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216278472 1.02E-06 2.68E-11 mr1017 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216278472 4.60E-06 2.50E-10 mr1018 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216278472 NA 6.64E-10 mr1019 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216278472 2.18E-06 NA mr1023 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216278472 1.16E-06 8.46E-12 mr1055 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216278472 3.42E-06 NA mr1079 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216278472 1.11E-07 5.53E-12 mr1132 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216278472 7.73E-06 NA mr1142 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216278472 NA 5.05E-07 mr1364 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216278472 7.91E-08 NA mr1390 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216278472 NA 2.50E-07 mr1443 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216278472 3.54E-08 NA mr1490 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216278472 7.64E-06 NA mr1490 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216278472 7.58E-06 NA mr1491 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216278472 7.00E-08 5.75E-13 mr1055_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216278472 1.99E-08 NA mr1132_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216278472 8.09E-06 NA mr1178_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216278472 4.08E-07 NA mr1178_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216278472 5.80E-08 NA mr1390_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216278472 5.65E-06 NA mr1490_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216278472 3.14E-08 NA mr1490_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216278472 NA 9.28E-06 mr1582_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251