Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1216273753:

Variant ID: vg1216273753 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 16273753
Reference Allele: A	Alternative Allele: T
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CACCAGTGTTACTTTATTTCTTTCAAATCAACTATTTTTCTTTCCACTGGTATGGTTGCAGCACACTTGTTTTCCATAGCTTTGATAAGTATTCAATAAT[A/T]
TTCATGCCATATAAAAGAATTGTTTACCCATAACTAGGAAGGAAGCCATCAATAAAAAGAAAAGACGACTCACTAATTAATTCAAAACATGACGAAGAAT

Reverse complement sequence

ATTCTTCGTCATGTTTTGAATTAATTAGTGAGTCGTCTTTTCTTTTTATTGATGGCTTCCTTCCTAGTTATGGGTAAACAATTCTTTTATATGGCATGAA[T/A]
ATTATTGAATACTTATCAAAGCTATGGAAAACAAGTGTGCTGCAACCATACCAGTGGAAAGAAAAATAGTTGATTTGAAAGAAATAAAGTAACACTGGTG

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	82.80%	9.90%	2.18%	5.08%	NA
All Indica	2759	83.50%	9.40%	3.62%	3.44%	NA
All Japonica	1512	87.00%	13.00%	0.00%	0.00%	NA
Aus	269	45.70%	0.70%	0.74%	52.79%	NA
Indica I	595	91.10%	5.50%	3.19%	0.17%	NA
Indica II	465	96.80%	0.90%	1.51%	0.86%	NA
Indica III	913	71.70%	15.60%	5.59%	7.12%	NA
Indica Intermediate	786	83.60%	10.30%	2.93%	3.18%	NA
Temperate Japonica	767	98.80%	1.20%	0.00%	0.00%	NA
Tropical Japonica	504	66.90%	33.10%	0.00%	0.00%	NA
Japonica Intermediate	241	91.30%	8.70%	0.00%	0.00%	NA
VI/Aromatic	96	93.80%	4.20%	1.04%	1.04%	NA
Intermediate	90	90.00%	7.80%	0.00%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1216273753	A -> DEL	N	N	silent_mutation	Average:34.275; most accessible tissue: Minghui63 flag leaf, score: 45.977	N	N	N	N
vg1216273753	A -> T	LOC_Os12g27650.1	upstream_gene_variant ; 4282.0bp to feature; MODIFIER	silent_mutation	Average:34.275; most accessible tissue: Minghui63 flag leaf, score: 45.977	N	N	N	N
vg1216273753	A -> T	LOC_Os12g27640.1	intron_variant ; MODIFIER	silent_mutation	Average:34.275; most accessible tissue: Minghui63 flag leaf, score: 45.977	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1216273753	NA	1.39E-10	mr1016	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216273753	9.96E-06	NA	mr1017	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216273753	3.41E-06	1.42E-10	mr1017	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216273753	NA	1.45E-09	mr1018	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216273753	NA	2.78E-09	mr1019	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216273753	9.57E-08	NA	mr1023	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216273753	1.41E-06	NA	mr1055	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216273753	1.39E-06	1.24E-11	mr1055	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216273753	4.32E-07	NA	mr1132	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216273753	2.25E-07	7.37E-12	mr1132	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216273753	7.20E-06	NA	mr1142	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216273753	NA	2.62E-07	mr1364	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216273753	6.95E-06	NA	mr1390	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216273753	NA	1.89E-07	mr1443	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216273753	3.18E-07	NA	mr1491	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216273753	NA	8.51E-06	mr1884	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216273753	2.06E-06	NA	mr1055_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216273753	1.59E-07	4.48E-12	mr1055_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216273753	2.03E-06	NA	mr1132_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216273753	8.59E-08	NA	mr1132_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216273753	4.27E-07	NA	mr1178_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216273753	7.32E-06	NA	mr1178_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216273753	NA	8.12E-08	mr1261_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216273753	1.47E-07	NA	mr1390_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216273753	1.06E-07	NA	mr1490_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251