\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1216273753:

Variant ID: vg1216273753 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 16273753
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CACCAGTGTTACTTTATTTCTTTCAAATCAACTATTTTTCTTTCCACTGGTATGGTTGCAGCACACTTGTTTTCCATAGCTTTGATAAGTATTCAATAAT[A/T]
TTCATGCCATATAAAAGAATTGTTTACCCATAACTAGGAAGGAAGCCATCAATAAAAAGAAAAGACGACTCACTAATTAATTCAAAACATGACGAAGAAT

Reverse complement sequence

ATTCTTCGTCATGTTTTGAATTAATTAGTGAGTCGTCTTTTCTTTTTATTGATGGCTTCCTTCCTAGTTATGGGTAAACAATTCTTTTATATGGCATGAA[T/A]
ATTATTGAATACTTATCAAAGCTATGGAAAACAAGTGTGCTGCAACCATACCAGTGGAAAGAAAAATAGTTGATTTGAAAGAAATAAAGTAACACTGGTG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 82.80% 9.90% 2.18% 5.08% NA
All Indica  2759 83.50% 9.40% 3.62% 3.44% NA
All Japonica  1512 87.00% 13.00% 0.00% 0.00% NA
Aus  269 45.70% 0.70% 0.74% 52.79% NA
Indica I  595 91.10% 5.50% 3.19% 0.17% NA
Indica II  465 96.80% 0.90% 1.51% 0.86% NA
Indica III  913 71.70% 15.60% 5.59% 7.12% NA
Indica Intermediate  786 83.60% 10.30% 2.93% 3.18% NA
Temperate Japonica  767 98.80% 1.20% 0.00% 0.00% NA
Tropical Japonica  504 66.90% 33.10% 0.00% 0.00% NA
Japonica Intermediate  241 91.30% 8.70% 0.00% 0.00% NA
VI/Aromatic  96 93.80% 4.20% 1.04% 1.04% NA
Intermediate  90 90.00% 7.80% 0.00% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1216273753 A -> DEL N N silent_mutation Average:34.275; most accessible tissue: Minghui63 flag leaf, score: 45.977 N N N N
vg1216273753 A -> T LOC_Os12g27650.1 upstream_gene_variant ; 4282.0bp to feature; MODIFIER silent_mutation Average:34.275; most accessible tissue: Minghui63 flag leaf, score: 45.977 N N N N
vg1216273753 A -> T LOC_Os12g27640.1 intron_variant ; MODIFIER silent_mutation Average:34.275; most accessible tissue: Minghui63 flag leaf, score: 45.977 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1216273753 NA 1.39E-10 mr1016 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216273753 9.96E-06 NA mr1017 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216273753 3.41E-06 1.42E-10 mr1017 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216273753 NA 1.45E-09 mr1018 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216273753 NA 2.78E-09 mr1019 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216273753 9.57E-08 NA mr1023 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216273753 1.41E-06 NA mr1055 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216273753 1.39E-06 1.24E-11 mr1055 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216273753 4.32E-07 NA mr1132 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216273753 2.25E-07 7.37E-12 mr1132 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216273753 7.20E-06 NA mr1142 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216273753 NA 2.62E-07 mr1364 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216273753 6.95E-06 NA mr1390 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216273753 NA 1.89E-07 mr1443 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216273753 3.18E-07 NA mr1491 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216273753 NA 8.51E-06 mr1884 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216273753 2.06E-06 NA mr1055_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216273753 1.59E-07 4.48E-12 mr1055_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216273753 2.03E-06 NA mr1132_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216273753 8.59E-08 NA mr1132_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216273753 4.27E-07 NA mr1178_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216273753 7.32E-06 NA mr1178_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216273753 NA 8.12E-08 mr1261_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216273753 1.47E-07 NA mr1390_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216273753 1.06E-07 NA mr1490_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251