\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1216261360:

Variant ID: vg1216261360 (JBrowse)Variation Type: INDEL
Chromosome: chr12Position: 16261360
Reference Allele: GTCCAAlternative Allele: ATCCA,G
Primary Allele: GTCCASecondary Allele: ATCCA

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CAAATGTTTACTATAGCACCACATTGTCAAATTATGGCATAATTAAGCTTAAAAAATTTGTCTTGCAATTTACATGCAAACTATGCAATTAGTTTTTTTC[GTCCA/ATCCA,G]
TATTTAATGTTACATGGATTTGTCCAAACATAAGATGGGACAGAAGTTTTAGAAGTTTAAAGGAAACTCTAAACACAGCCTCTTTTTGGATTTTTTTTTT

Reverse complement sequence

AAAAAAAAAATCCAAAAAGAGGCTGTGTTTAGAGTTTCCTTTAAACTTCTAAAACTTCTGTCCCATCTTATGTTTGGACAAATCCATGTAACATTAAATA[TGGAC/TGGAT,C]
GAAAAAAACTAATTGCATAGTTTGCATGTAAATTGCAAGACAAATTTTTTAAGCTTAATTATGCCATAATTTGACAATGTGGTGCTATAGTAAACATTTG

Allele Frequencies:

Populations Population SizeFrequency of GTCCA(primary allele) Frequency of ATCCA(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.40% 22.30% 1.80% 9.94% G: 3.51%
All Indica  2759 47.60% 37.30% 2.65% 11.82% G: 0.65%
All Japonica  1512 92.50% 0.90% 0.26% 0.07% G: 6.28%
Aus  269 31.20% 0.70% 1.49% 52.04% G: 14.50%
Indica I  595 31.90% 55.10% 3.70% 9.24% NA
Indica II  465 26.70% 40.00% 5.81% 27.31% G: 0.22%
Indica III  913 70.30% 22.30% 0.77% 5.70% G: 0.88%
Indica Intermediate  786 45.50% 39.40% 2.16% 11.70% G: 1.15%
Temperate Japonica  767 96.60% 0.90% 0.13% 0.00% G: 2.35%
Tropical Japonica  504 86.50% 1.00% 0.60% 0.00% G: 11.90%
Japonica Intermediate  241 91.70% 0.80% 0.00% 0.41% G: 7.05%
VI/Aromatic  96 89.60% 2.10% 0.00% 0.00% G: 8.33%
Intermediate  90 76.70% 8.90% 4.44% 3.33% G: 6.67%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1216261360 GTCCA -> DEL N N silent_mutation Average:41.46; most accessible tissue: Minghui63 panicle, score: 84.552 N N N N
vg1216261360 GTCCA -> G LOC_Os12g27630.1 downstream_gene_variant ; 1354.0bp to feature; MODIFIER silent_mutation Average:41.46; most accessible tissue: Minghui63 panicle, score: 84.552 N N N N
vg1216261360 GTCCA -> G LOC_Os12g27610-LOC_Os12g27630 intergenic_region ; MODIFIER silent_mutation Average:41.46; most accessible tissue: Minghui63 panicle, score: 84.552 N N N N
vg1216261360 GTCCA -> ATCCA LOC_Os12g27630.1 downstream_gene_variant ; 1355.0bp to feature; MODIFIER silent_mutation Average:41.46; most accessible tissue: Minghui63 panicle, score: 84.552 N N N N
vg1216261360 GTCCA -> ATCCA LOC_Os12g27610-LOC_Os12g27630 intergenic_region ; MODIFIER silent_mutation Average:41.46; most accessible tissue: Minghui63 panicle, score: 84.552 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1216261360 GTCCA ATCCA 0.02 0.01 0.0 0.01 0.01 0.02
vg1216261360 GTCCA G -0.17 0.0 0.0 -0.08 -0.1 -0.11

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1216261360 NA 2.17E-13 mr1016 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216261360 NA 1.39E-09 mr1023 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216261360 NA 1.81E-12 mr1034 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216261360 NA 1.41E-11 mr1055 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216261360 5.43E-06 NA mr1178 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216261360 2.51E-07 1.66E-12 mr1178 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216261360 NA 1.80E-09 mr1610 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216261360 NA 2.10E-06 mr1610 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216261360 NA 6.12E-06 mr1805 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216261360 NA 1.23E-09 mr1023_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216261360 NA 1.31E-12 mr1055_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216261360 NA 8.31E-13 mr1178_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251