\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1216161719:

Variant ID: vg1216161719 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 16161719
Reference Allele: GAlternative Allele: C,A
Primary Allele: GSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GTACAAATCTTTGGTGCATGACTTGTTGAAGGTGGTGGGAGTTGATTTGGGGAATAAGTTAGAGACGAAGGAGTCTAAATACAAAAGTGTACATGCCGTG[G/C,A]
ATAGCCGTACCAGAGCTGCCACATCTGCATCTAATCTCGGGTGATACAGTAAAGTAATAATAGGATTTAGATGTACAGTTTAGATGTTTATCAACATTGA

Reverse complement sequence

TCAATGTTGATAAACATCTAAACTGTACATCTAAATCCTATTATTACTTTACTGTATCACCCGAGATTAGATGCAGATGTGGCAGCTCTGGTACGGCTAT[C/G,T]
CACGGCATGTACACTTTTGTATTTAGACTCCTTCGTCTCTAACTTATTCCCCAAATCAACTCCCACCACCTTCAACAAGTCATGCACCAAAGATTTGTAC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 96.10% 3.80% 0.00% 0.00% A: 0.06%
All Indica  2759 99.20% 0.70% 0.00% 0.00% A: 0.11%
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 40.90% 59.10% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.60% 0.40% 0.00% 0.00% NA
Indica III  913 99.00% 0.70% 0.00% 0.00% A: 0.33%
Indica Intermediate  786 98.50% 1.50% 0.00% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 100.00% 0.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1216161719 G -> C LOC_Os12g27460.1 downstream_gene_variant ; 3763.0bp to feature; MODIFIER silent_mutation Average:42.518; most accessible tissue: Callus, score: 68.699 N N N N
vg1216161719 G -> C LOC_Os12g27460-LOC_Os12g27470 intergenic_region ; MODIFIER silent_mutation Average:42.518; most accessible tissue: Callus, score: 68.699 N N N N
vg1216161719 G -> A LOC_Os12g27460.1 downstream_gene_variant ; 3763.0bp to feature; MODIFIER silent_mutation Average:42.518; most accessible tissue: Callus, score: 68.699 N N N N
vg1216161719 G -> A LOC_Os12g27460-LOC_Os12g27470 intergenic_region ; MODIFIER silent_mutation Average:42.518; most accessible tissue: Callus, score: 68.699 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1216161719 NA 3.70E-06 mr1004 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216161719 NA 2.31E-06 mr1058 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216161719 NA 2.37E-06 mr1345 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216161719 NA 8.08E-06 mr1427 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216161719 NA 1.62E-09 mr1730 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216161719 NA 2.73E-08 mr1787 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216161719 NA 1.04E-08 mr1510_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251