\
| Variant ID: vg1216161719 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 16161719 |
| Reference Allele: G | Alternative Allele: C,A |
| Primary Allele: G | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
GTACAAATCTTTGGTGCATGACTTGTTGAAGGTGGTGGGAGTTGATTTGGGGAATAAGTTAGAGACGAAGGAGTCTAAATACAAAAGTGTACATGCCGTG[G/C,A]
ATAGCCGTACCAGAGCTGCCACATCTGCATCTAATCTCGGGTGATACAGTAAAGTAATAATAGGATTTAGATGTACAGTTTAGATGTTTATCAACATTGA
TCAATGTTGATAAACATCTAAACTGTACATCTAAATCCTATTATTACTTTACTGTATCACCCGAGATTAGATGCAGATGTGGCAGCTCTGGTACGGCTAT[C/G,T]
CACGGCATGTACACTTTTGTATTTAGACTCCTTCGTCTCTAACTTATTCCCCAAATCAACTCCCACCACCTTCAACAAGTCATGCACCAAAGATTTGTAC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 96.10% | 3.80% | 0.00% | 0.00% | A: 0.06% |
| All Indica | 2759 | 99.20% | 0.70% | 0.00% | 0.00% | A: 0.11% |
| All Japonica | 1512 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 40.90% | 59.10% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.00% | 0.70% | 0.00% | 0.00% | A: 0.33% |
| Indica Intermediate | 786 | 98.50% | 1.50% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1216161719 | G -> C | LOC_Os12g27460.1 | downstream_gene_variant ; 3763.0bp to feature; MODIFIER | silent_mutation | Average:42.518; most accessible tissue: Callus, score: 68.699 | N | N | N | N |
| vg1216161719 | G -> C | LOC_Os12g27460-LOC_Os12g27470 | intergenic_region ; MODIFIER | silent_mutation | Average:42.518; most accessible tissue: Callus, score: 68.699 | N | N | N | N |
| vg1216161719 | G -> A | LOC_Os12g27460.1 | downstream_gene_variant ; 3763.0bp to feature; MODIFIER | silent_mutation | Average:42.518; most accessible tissue: Callus, score: 68.699 | N | N | N | N |
| vg1216161719 | G -> A | LOC_Os12g27460-LOC_Os12g27470 | intergenic_region ; MODIFIER | silent_mutation | Average:42.518; most accessible tissue: Callus, score: 68.699 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1216161719 | NA | 3.70E-06 | mr1004 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216161719 | NA | 2.31E-06 | mr1058 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216161719 | NA | 2.37E-06 | mr1345 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216161719 | NA | 8.08E-06 | mr1427 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216161719 | NA | 1.62E-09 | mr1730 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216161719 | NA | 2.73E-08 | mr1787 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216161719 | NA | 1.04E-08 | mr1510_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |