\
| Variant ID: vg1216158559 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 16158559 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 100. )
TAAAGTATTGCATACCAAGTCAAGTGAAAATCTCGCATATTTATTGAAAAGTTATTACCTGTATCCCCTTTTGAAAGATGCATTCGAGGGATTATGATGA[T/C]
GAGACTTACAGAAATGCAAAATTGTAGGGGAGAATTTCATGGACTCACTTGCCAAACTAGGTTCAGAATGACAAAGTACCCAATAAAAAAATTGGGTGGG
CCCACCCAATTTTTTTATTGGGTACTTTGTCATTCTGAACCTAGTTTGGCAAGTGAGTCCATGAAATTCTCCCCTACAATTTTGCATTTCTGTAAGTCTC[A/G]
TCATCATAATCCCTCGAATGCATCTTTCAAAAGGGGATACAGGTAATAACTTTTCAATAAATATGCGAGATTTTCACTTGACTTGGTATGCAATACTTTA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 90.80% | 5.50% | 0.11% | 3.55% | NA |
| All Indica | 2759 | 97.20% | 2.00% | 0.00% | 0.72% | NA |
| All Japonica | 1512 | 87.20% | 12.70% | 0.00% | 0.07% | NA |
| Aus | 269 | 42.80% | 0.70% | 1.86% | 54.65% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 90.50% | 9.00% | 0.00% | 0.43% | NA |
| Indica III | 913 | 98.90% | 0.40% | 0.00% | 0.66% | NA |
| Indica Intermediate | 786 | 97.20% | 1.30% | 0.00% | 1.53% | NA |
| Temperate Japonica | 767 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 65.50% | 34.50% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 93.40% | 6.20% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 86.70% | 13.30% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1216158559 | T -> C | LOC_Os12g27460.1 | downstream_gene_variant ; 603.0bp to feature; MODIFIER | silent_mutation | Average:41.293; most accessible tissue: Callus, score: 64.241 | N | N | N | N |
| vg1216158559 | T -> C | LOC_Os12g27460-LOC_Os12g27470 | intergenic_region ; MODIFIER | silent_mutation | Average:41.293; most accessible tissue: Callus, score: 64.241 | N | N | N | N |
| vg1216158559 | T -> DEL | N | N | silent_mutation | Average:41.293; most accessible tissue: Callus, score: 64.241 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1216158559 | 2.98E-22 | NA | mr1016 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216158559 | 3.65E-10 | NA | mr1016 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216158559 | 1.06E-19 | NA | mr1017 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216158559 | 4.07E-10 | NA | mr1017 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216158559 | 2.36E-18 | NA | mr1018 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216158559 | 3.83E-09 | NA | mr1018 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216158559 | 2.31E-11 | NA | mr1019 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216158559 | 7.69E-08 | NA | mr1019 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216158559 | 4.12E-11 | NA | mr1022 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216158559 | 3.25E-17 | NA | mr1023 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216158559 | 2.53E-06 | NA | mr1023 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216158559 | 3.85E-23 | NA | mr1055 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216158559 | 6.89E-11 | NA | mr1055 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216158559 | 1.38E-18 | NA | mr1079 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216158559 | 4.21E-07 | NA | mr1079 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216158559 | 1.81E-20 | NA | mr1132 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216158559 | 2.04E-08 | NA | mr1132 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216158559 | 1.13E-17 | NA | mr1142 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216158559 | 6.27E-07 | NA | mr1142 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216158559 | 6.67E-13 | NA | mr1178 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216158559 | 2.67E-18 | NA | mr1390 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216158559 | 8.32E-09 | NA | mr1390 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216158559 | 1.62E-18 | NA | mr1489 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216158559 | 2.79E-07 | NA | mr1489 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216158559 | 6.51E-17 | NA | mr1490 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216158559 | 2.29E-08 | NA | mr1490 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216158559 | 5.74E-19 | NA | mr1491 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216158559 | 1.58E-07 | NA | mr1491 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216158559 | 4.13E-06 | NA | mr1546 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216158559 | NA | 6.97E-06 | mr1697 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216158559 | 1.37E-11 | NA | mr1778 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216158559 | 1.05E-06 | NA | mr1778 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216158559 | 2.47E-06 | NA | mr1951 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216158559 | 1.57E-06 | NA | mr1951 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216158559 | 4.59E-15 | NA | mr1019_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216158559 | 1.22E-06 | NA | mr1019_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216158559 | 9.04E-14 | NA | mr1022_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216158559 | 3.50E-20 | NA | mr1023_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216158559 | 1.10E-08 | NA | mr1023_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216158559 | 7.14E-26 | NA | mr1055_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216158559 | 2.06E-10 | NA | mr1055_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216158559 | 2.36E-20 | NA | mr1079_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216158559 | 7.90E-09 | NA | mr1079_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216158559 | 5.47E-27 | NA | mr1132_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216158559 | 1.61E-11 | NA | mr1132_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216158559 | 5.21E-17 | NA | mr1178_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216158559 | 1.01E-06 | NA | mr1178_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216158559 | 3.48E-06 | NA | mr1261_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216158559 | 4.54E-06 | NA | mr1261_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216158559 | 1.75E-23 | NA | mr1390_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216158559 | 5.33E-12 | NA | mr1390_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216158559 | 1.01E-21 | NA | mr1489_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216158559 | 4.73E-08 | NA | mr1489_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216158559 | 2.58E-20 | NA | mr1490_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216158559 | 6.80E-12 | NA | mr1490_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216158559 | 8.64E-06 | NA | mr1769_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216158559 | 1.46E-11 | NA | mr1778_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216158559 | 2.17E-06 | NA | mr1778_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |