\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1216138955:

Variant ID: vg1216138955 (JBrowse)Variation Type: INDEL
Chromosome: chr12Position: 16138955
Reference Allele: TAlternative Allele: TG,G
Primary Allele: TGSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGACGTTGCATACATGCTTTAGTTTTCTTCATACGAAATTTCCAATATTCATGTACTTATCTGTGTGCAGATTGCTGTTAAATAAAATGTCATATTTCTT[T/TG,G]
TCTTACATGTTGTGCCACTAAATTTCCGAGGAAAATATACTCACCTATTTAGTACTAACAATACGAAGGTTTAATAAAGGGTACCTACAAATTTAGCCAT

Reverse complement sequence

ATGGCTAAATTTGTAGGTACCCTTTATTAAACCTTCGTATTGTTAGTACTAAATAGGTGAGTATATTTTCCTCGGAAATTTAGTGGCACAACATGTAAGA[A/CA,C]
AAGAAATATGACATTTTATTTAACAGCAATCTGCACACAGATAAGTACATGAATATTGGAAATTTCGTATGAAGAAAACTAAAGCATGTATGCAACGTCA

Allele Frequencies:

Populations Population SizeFrequency of TG(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.60% 26.10% 0.66% 0.00% G: 5.67%
All Indica  2759 93.30% 3.60% 0.91% 0.00% G: 2.21%
All Japonica  1512 22.90% 64.10% 0.26% 0.00% G: 12.70%
Aus  269 80.70% 18.20% 0.37% 0.00% G: 0.74%
Indica I  595 94.50% 3.40% 2.02% 0.00% G: 0.17%
Indica II  465 84.90% 5.20% 0.86% 0.00% G: 9.03%
Indica III  913 97.60% 1.40% 0.33% 0.00% G: 0.66%
Indica Intermediate  786 92.40% 5.30% 0.76% 0.00% G: 1.53%
Temperate Japonica  767 4.40% 95.30% 0.00% 0.00% G: 0.26%
Tropical Japonica  504 53.00% 11.70% 0.60% 0.00% G: 34.72%
Japonica Intermediate  241 19.10% 74.30% 0.41% 0.00% G: 6.22%
VI/Aromatic  96 17.70% 82.30% 0.00% 0.00% NA
Intermediate  90 42.20% 42.20% 1.11% 0.00% G: 14.44%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1216138955 T -> G LOC_Os12g27410.1 downstream_gene_variant ; 502.0bp to feature; MODIFIER silent_mutation Average:51.935; most accessible tissue: Callus, score: 69.831 N N N N
vg1216138955 T -> G LOC_Os12g27420.1 downstream_gene_variant ; 884.0bp to feature; MODIFIER silent_mutation Average:51.935; most accessible tissue: Callus, score: 69.831 N N N N
vg1216138955 T -> G LOC_Os12g27430.1 downstream_gene_variant ; 3449.0bp to feature; MODIFIER silent_mutation Average:51.935; most accessible tissue: Callus, score: 69.831 N N N N
vg1216138955 T -> G LOC_Os12g27410-LOC_Os12g27420 intergenic_region ; MODIFIER silent_mutation Average:51.935; most accessible tissue: Callus, score: 69.831 N N N N
vg1216138955 T -> TG LOC_Os12g27410.1 downstream_gene_variant ; 503.0bp to feature; MODIFIER silent_mutation Average:51.935; most accessible tissue: Callus, score: 69.831 N N N N
vg1216138955 T -> TG LOC_Os12g27420.1 downstream_gene_variant ; 883.0bp to feature; MODIFIER silent_mutation Average:51.935; most accessible tissue: Callus, score: 69.831 N N N N
vg1216138955 T -> TG LOC_Os12g27430.1 downstream_gene_variant ; 3448.0bp to feature; MODIFIER silent_mutation Average:51.935; most accessible tissue: Callus, score: 69.831 N N N N
vg1216138955 T -> TG LOC_Os12g27410-LOC_Os12g27420 intergenic_region ; MODIFIER silent_mutation Average:51.935; most accessible tissue: Callus, score: 69.831 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1216138955 1.47E-16 NA mr1016 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216138955 3.99E-11 NA mr1016 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216138955 5.18E-14 NA mr1017 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216138955 4.54E-10 NA mr1017 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216138955 5.79E-17 NA mr1018 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216138955 7.61E-11 NA mr1018 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216138955 5.73E-13 NA mr1019 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216138955 3.98E-10 NA mr1019 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216138955 3.17E-08 NA mr1022 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216138955 7.50E-15 NA mr1023 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216138955 1.72E-07 NA mr1023 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216138955 1.72E-18 NA mr1055 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216138955 1.07E-12 NA mr1055 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216138955 4.87E-14 NA mr1079 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216138955 9.52E-08 NA mr1079 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216138955 1.12E-17 NA mr1132 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216138955 1.03E-09 NA mr1132 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216138955 2.27E-16 NA mr1142 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216138955 3.39E-08 NA mr1142 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216138955 6.58E-11 NA mr1178 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216138955 NA 1.85E-07 mr1382 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216138955 2.22E-14 NA mr1390 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216138955 1.51E-09 NA mr1390 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216138955 1.05E-17 NA mr1489 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216138955 8.61E-09 NA mr1489 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216138955 5.06E-13 NA mr1490 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216138955 3.03E-09 NA mr1490 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216138955 2.65E-17 NA mr1491 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216138955 6.89E-09 NA mr1491 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216138955 NA 2.86E-06 mr1697 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216138955 1.52E-13 NA mr1778 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216138955 2.90E-09 NA mr1778 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216138955 5.92E-06 NA mr1951 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216138955 8.12E-16 NA mr1019_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216138955 3.78E-09 NA mr1019_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216138955 6.84E-11 NA mr1022_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216138955 1.01E-19 NA mr1023_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216138955 5.06E-11 NA mr1023_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216138955 2.91E-22 NA mr1055_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216138955 3.54E-14 NA mr1055_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216138955 9.64E-16 NA mr1079_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216138955 1.70E-09 NA mr1079_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216138955 4.59E-24 NA mr1132_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216138955 8.13E-15 NA mr1132_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216138955 1.67E-15 NA mr1178_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216138955 2.16E-08 NA mr1178_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216138955 4.18E-08 NA mr1261_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216138955 1.09E-07 NA mr1261_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216138955 6.02E-19 NA mr1390_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216138955 7.30E-14 NA mr1390_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216138955 1.97E-21 NA mr1489_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216138955 1.58E-10 NA mr1489_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216138955 7.38E-17 NA mr1490_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216138955 2.64E-14 NA mr1490_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216138955 7.68E-14 NA mr1778_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216138955 3.41E-09 NA mr1778_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251