\
| Variant ID: vg1216136207 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 16136207 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 112. )
GTCACAAGTTGAGTTTAAAGATGGGGACTCACAATTCTGGGCCAGCCTTATGAAGGTCAAGCGTGACTTTTTACTATTTGGCAAATTCATTATGAGAGAT[G/A]
GTGCCCAAATCAGGTTTTGGGAAGACAAGTGGTTGGGAGAAGCACCATTGCAAGAACAATATCCTTGTCTATACAATATAGTTAGGAATAAACATGATAC
GTATCATGTTTATTCCTAACTATATTGTATAGACAAGGATATTGTTCTTGCAATGGTGCTTCTCCCAACCACTTGTCTTCCCAAAACCTGATTTGGGCAC[C/T]
ATCTCTCATAATGAATTTGCCAAATAGTAAAAAGTCACGCTTGACCTTCATAAGGCTGGCCCAGAATTGTGAGTCCCCATCTTTAAACTCAACTTGTGAC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 86.80% | 4.70% | 8.44% | 0.08% | NA |
| All Indica | 2759 | 83.70% | 4.70% | 11.60% | 0.00% | NA |
| All Japonica | 1512 | 89.40% | 5.80% | 4.56% | 0.26% | NA |
| Aus | 269 | 98.90% | 0.70% | 0.37% | 0.00% | NA |
| Indica I | 595 | 79.50% | 6.20% | 14.29% | 0.00% | NA |
| Indica II | 465 | 92.30% | 3.00% | 4.73% | 0.00% | NA |
| Indica III | 913 | 83.10% | 3.80% | 13.03% | 0.00% | NA |
| Indica Intermediate | 786 | 82.30% | 5.70% | 11.96% | 0.00% | NA |
| Temperate Japonica | 767 | 98.40% | 0.40% | 1.04% | 0.13% | NA |
| Tropical Japonica | 504 | 75.40% | 14.50% | 9.72% | 0.40% | NA |
| Japonica Intermediate | 241 | 89.60% | 5.00% | 4.98% | 0.41% | NA |
| VI/Aromatic | 96 | 99.00% | 0.00% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 88.90% | 2.20% | 8.89% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1216136207 | G -> DEL | N | N | silent_mutation | Average:10.659; most accessible tissue: Callus, score: 14.169 | N | N | N | N |
| vg1216136207 | G -> A | LOC_Os12g27400.1 | upstream_gene_variant ; 3924.0bp to feature; MODIFIER | silent_mutation | Average:10.659; most accessible tissue: Callus, score: 14.169 | N | N | N | N |
| vg1216136207 | G -> A | LOC_Os12g27420.1 | downstream_gene_variant ; 3632.0bp to feature; MODIFIER | silent_mutation | Average:10.659; most accessible tissue: Callus, score: 14.169 | N | N | N | N |
| vg1216136207 | G -> A | LOC_Os12g27410.1 | intron_variant ; MODIFIER | silent_mutation | Average:10.659; most accessible tissue: Callus, score: 14.169 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1216136207 | 8.49E-06 | 5.42E-07 | mr1537 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216136207 | 6.05E-06 | 6.05E-06 | mr1891 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216136207 | 9.97E-07 | NA | mr1055_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216136207 | 2.96E-07 | NA | mr1132_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216136207 | 4.03E-06 | NA | mr1490_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |