\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1216136207:

Variant ID: vg1216136207 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 16136207
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 112. )

Flanking Sequence (100 bp) in Reference Genome:


GTCACAAGTTGAGTTTAAAGATGGGGACTCACAATTCTGGGCCAGCCTTATGAAGGTCAAGCGTGACTTTTTACTATTTGGCAAATTCATTATGAGAGAT[G/A]
GTGCCCAAATCAGGTTTTGGGAAGACAAGTGGTTGGGAGAAGCACCATTGCAAGAACAATATCCTTGTCTATACAATATAGTTAGGAATAAACATGATAC

Reverse complement sequence

GTATCATGTTTATTCCTAACTATATTGTATAGACAAGGATATTGTTCTTGCAATGGTGCTTCTCCCAACCACTTGTCTTCCCAAAACCTGATTTGGGCAC[C/T]
ATCTCTCATAATGAATTTGCCAAATAGTAAAAAGTCACGCTTGACCTTCATAAGGCTGGCCCAGAATTGTGAGTCCCCATCTTTAAACTCAACTTGTGAC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 86.80% 4.70% 8.44% 0.08% NA
All Indica  2759 83.70% 4.70% 11.60% 0.00% NA
All Japonica  1512 89.40% 5.80% 4.56% 0.26% NA
Aus  269 98.90% 0.70% 0.37% 0.00% NA
Indica I  595 79.50% 6.20% 14.29% 0.00% NA
Indica II  465 92.30% 3.00% 4.73% 0.00% NA
Indica III  913 83.10% 3.80% 13.03% 0.00% NA
Indica Intermediate  786 82.30% 5.70% 11.96% 0.00% NA
Temperate Japonica  767 98.40% 0.40% 1.04% 0.13% NA
Tropical Japonica  504 75.40% 14.50% 9.72% 0.40% NA
Japonica Intermediate  241 89.60% 5.00% 4.98% 0.41% NA
VI/Aromatic  96 99.00% 0.00% 1.04% 0.00% NA
Intermediate  90 88.90% 2.20% 8.89% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1216136207 G -> DEL N N silent_mutation Average:10.659; most accessible tissue: Callus, score: 14.169 N N N N
vg1216136207 G -> A LOC_Os12g27400.1 upstream_gene_variant ; 3924.0bp to feature; MODIFIER silent_mutation Average:10.659; most accessible tissue: Callus, score: 14.169 N N N N
vg1216136207 G -> A LOC_Os12g27420.1 downstream_gene_variant ; 3632.0bp to feature; MODIFIER silent_mutation Average:10.659; most accessible tissue: Callus, score: 14.169 N N N N
vg1216136207 G -> A LOC_Os12g27410.1 intron_variant ; MODIFIER silent_mutation Average:10.659; most accessible tissue: Callus, score: 14.169 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1216136207 8.49E-06 5.42E-07 mr1537 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216136207 6.05E-06 6.05E-06 mr1891 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216136207 9.97E-07 NA mr1055_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216136207 2.96E-07 NA mr1132_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216136207 4.03E-06 NA mr1490_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251