\
| Variant ID: vg1216132874 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 16132874 |
| Reference Allele: G | Alternative Allele: T |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 186. )
AAGACCGAAGGGCTTCGTCGTAGTGATCGTTGCAATGCAGCCATATCATCTAATGGCATTGCAGCTGCCGATGAGGATTCAACGACGAAGGCTAAATGCA[G/T]
GGCAGCGATGAGAAATCTGGATGGGCCAATGATGTCCAAGACGGCTGACTTAGCGAAGTCATCACTTTCGTCTACATCATACCTTGACCCTTCTATAGGT
ACCTATAGAAGGGTCAAGGTATGATGTAGACGAAAGTGATGACTTCGCTAAGTCAGCCGTCTTGGACATCATTGGCCCATCCAGATTTCTCATCGCTGCC[C/A]
TGCATTTAGCCTTCGTCGTTGAATCCTCATCGGCAGCTGCAATGCCATTAGATGATATGGCTGCATTGCAACGATCACTACGACGAAGCCCTTCGGTCTT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 62.50% | 31.10% | 2.20% | 4.21% | NA |
| All Indica | 2759 | 50.30% | 45.30% | 2.68% | 1.63% | NA |
| All Japonica | 1512 | 76.50% | 12.40% | 1.59% | 9.52% | NA |
| Aus | 269 | 92.90% | 5.90% | 1.12% | 0.00% | NA |
| Indica I | 595 | 47.10% | 47.20% | 4.03% | 1.68% | NA |
| Indica II | 465 | 59.80% | 35.30% | 2.37% | 2.58% | NA |
| Indica III | 913 | 47.90% | 50.20% | 1.75% | 0.22% | NA |
| Indica Intermediate | 786 | 50.10% | 44.30% | 2.93% | 2.67% | NA |
| Temperate Japonica | 767 | 97.30% | 0.40% | 0.00% | 2.35% | NA |
| Tropical Japonica | 504 | 41.70% | 33.50% | 4.17% | 20.63% | NA |
| Japonica Intermediate | 241 | 83.40% | 6.20% | 1.24% | 9.13% | NA |
| VI/Aromatic | 96 | 94.80% | 1.00% | 1.04% | 3.12% | NA |
| Intermediate | 90 | 73.30% | 16.70% | 2.22% | 7.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1216132874 | G -> DEL | N | N | silent_mutation | Average:58.174; most accessible tissue: Zhenshan97 young leaf, score: 76.44 | N | N | N | N |
| vg1216132874 | G -> T | LOC_Os12g27400.1 | upstream_gene_variant ; 591.0bp to feature; MODIFIER | silent_mutation | Average:58.174; most accessible tissue: Zhenshan97 young leaf, score: 76.44 | N | N | N | N |
| vg1216132874 | G -> T | LOC_Os12g27410.1 | upstream_gene_variant ; 8.0bp to feature; MODIFIER | silent_mutation | Average:58.174; most accessible tissue: Zhenshan97 young leaf, score: 76.44 | N | N | N | N |
| vg1216132874 | G -> T | LOC_Os12g27400-LOC_Os12g27410 | intergenic_region ; MODIFIER | silent_mutation | Average:58.174; most accessible tissue: Zhenshan97 young leaf, score: 76.44 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1216132874 | 3.63E-07 | NA | mr1023 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216132874 | 7.67E-07 | NA | mr1023 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216132874 | NA | 1.95E-07 | mr1090_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216132874 | NA | 3.05E-06 | mr1121_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216132874 | NA | 8.35E-08 | mr1526_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |