\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1216132874:

Variant ID: vg1216132874 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 16132874
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 186. )

Flanking Sequence (100 bp) in Reference Genome:


AAGACCGAAGGGCTTCGTCGTAGTGATCGTTGCAATGCAGCCATATCATCTAATGGCATTGCAGCTGCCGATGAGGATTCAACGACGAAGGCTAAATGCA[G/T]
GGCAGCGATGAGAAATCTGGATGGGCCAATGATGTCCAAGACGGCTGACTTAGCGAAGTCATCACTTTCGTCTACATCATACCTTGACCCTTCTATAGGT

Reverse complement sequence

ACCTATAGAAGGGTCAAGGTATGATGTAGACGAAAGTGATGACTTCGCTAAGTCAGCCGTCTTGGACATCATTGGCCCATCCAGATTTCTCATCGCTGCC[C/A]
TGCATTTAGCCTTCGTCGTTGAATCCTCATCGGCAGCTGCAATGCCATTAGATGATATGGCTGCATTGCAACGATCACTACGACGAAGCCCTTCGGTCTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.50% 31.10% 2.20% 4.21% NA
All Indica  2759 50.30% 45.30% 2.68% 1.63% NA
All Japonica  1512 76.50% 12.40% 1.59% 9.52% NA
Aus  269 92.90% 5.90% 1.12% 0.00% NA
Indica I  595 47.10% 47.20% 4.03% 1.68% NA
Indica II  465 59.80% 35.30% 2.37% 2.58% NA
Indica III  913 47.90% 50.20% 1.75% 0.22% NA
Indica Intermediate  786 50.10% 44.30% 2.93% 2.67% NA
Temperate Japonica  767 97.30% 0.40% 0.00% 2.35% NA
Tropical Japonica  504 41.70% 33.50% 4.17% 20.63% NA
Japonica Intermediate  241 83.40% 6.20% 1.24% 9.13% NA
VI/Aromatic  96 94.80% 1.00% 1.04% 3.12% NA
Intermediate  90 73.30% 16.70% 2.22% 7.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1216132874 G -> DEL N N silent_mutation Average:58.174; most accessible tissue: Zhenshan97 young leaf, score: 76.44 N N N N
vg1216132874 G -> T LOC_Os12g27400.1 upstream_gene_variant ; 591.0bp to feature; MODIFIER silent_mutation Average:58.174; most accessible tissue: Zhenshan97 young leaf, score: 76.44 N N N N
vg1216132874 G -> T LOC_Os12g27410.1 upstream_gene_variant ; 8.0bp to feature; MODIFIER silent_mutation Average:58.174; most accessible tissue: Zhenshan97 young leaf, score: 76.44 N N N N
vg1216132874 G -> T LOC_Os12g27400-LOC_Os12g27410 intergenic_region ; MODIFIER silent_mutation Average:58.174; most accessible tissue: Zhenshan97 young leaf, score: 76.44 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1216132874 3.63E-07 NA mr1023 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216132874 7.67E-07 NA mr1023 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216132874 NA 1.95E-07 mr1090_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216132874 NA 3.05E-06 mr1121_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216132874 NA 8.35E-08 mr1526_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251