Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1216132870:

Variant ID: vg1216132870 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 16132870
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.88, C: 0.12, others allele: 0.00, population size: 84. )

Flanking Sequence (100 bp) in Reference Genome:

GGAAAAGACCGAAGGGCTTCGTCGTAGTGATCGTTGCAATGCAGCCATATCATCTAATGGCATTGCAGCTGCCGATGAGGATTCAACGACGAAGGCTAAA[T/C]
GCAGGGCAGCGATGAGAAATCTGGATGGGCCAATGATGTCCAAGACGGCTGACTTAGCGAAGTCATCACTTTCGTCTACATCATACCTTGACCCTTCTAT

Reverse complement sequence

ATAGAAGGGTCAAGGTATGATGTAGACGAAAGTGATGACTTCGCTAAGTCAGCCGTCTTGGACATCATTGGCCCATCCAGATTTCTCATCGCTGCCCTGC[A/G]
TTTAGCCTTCGTCGTTGAATCCTCATCGGCAGCTGCAATGCCATTAGATGATATGGCTGCATTGCAACGATCACTACGACGAAGCCCTTCGGTCTTTTCC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	54.60%	27.60%	6.41%	11.32%	NA
All Indica	2759	75.20%	5.50%	5.98%	13.27%	NA
All Japonica	1512	23.10%	64.70%	3.04%	9.13%	NA
Aus	269	41.60%	21.20%	28.62%	8.55%	NA
Indica I	595	78.80%	7.20%	5.71%	8.24%	NA
Indica II	465	61.70%	7.50%	4.52%	26.24%	NA
Indica III	913	81.50%	2.10%	5.59%	10.84%	NA
Indica Intermediate	786	73.20%	7.10%	7.51%	12.21%	NA
Temperate Japonica	767	1.70%	95.40%	1.30%	1.56%	NA
Tropical Japonica	504	59.70%	13.10%	5.75%	21.43%	NA
Japonica Intermediate	241	14.90%	74.70%	2.90%	7.47%	NA
VI/Aromatic	96	7.30%	82.30%	6.25%	4.17%	NA
Intermediate	90	42.20%	43.30%	10.00%	4.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1216132870	T -> C	LOC_Os12g27400.1	upstream_gene_variant ; 587.0bp to feature; MODIFIER	silent_mutation	Average:59.026; most accessible tissue: Zhenshan97 young leaf, score: 78.044	N	N	N	N
vg1216132870	T -> C	LOC_Os12g27410.1	upstream_gene_variant ; 12.0bp to feature; MODIFIER	silent_mutation	Average:59.026; most accessible tissue: Zhenshan97 young leaf, score: 78.044	N	N	N	N
vg1216132870	T -> C	LOC_Os12g27400-LOC_Os12g27410	intergenic_region ; MODIFIER	silent_mutation	Average:59.026; most accessible tissue: Zhenshan97 young leaf, score: 78.044	N	N	N	N
vg1216132870	T -> DEL	N	N	silent_mutation	Average:59.026; most accessible tissue: Zhenshan97 young leaf, score: 78.044	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1216132870	9.65E-08	NA	mr1016	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216132870	NA	1.29E-10	mr1016	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216132870	1.81E-10	6.30E-39	mr1017	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216132870	NA	3.91E-11	mr1017	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216132870	7.74E-08	NA	mr1018	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216132870	NA	5.22E-11	mr1018	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216132870	9.99E-07	NA	mr1019	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216132870	NA	8.40E-10	mr1019	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216132870	NA	3.79E-28	mr1022	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216132870	7.55E-10	2.07E-61	mr1023	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216132870	3.28E-10	7.96E-39	mr1055	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216132870	NA	1.69E-11	mr1055	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216132870	8.75E-08	9.38E-47	mr1079	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216132870	3.58E-10	NA	mr1132	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216132870	NA	1.38E-12	mr1132	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216132870	6.83E-08	NA	mr1142	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216132870	1.91E-06	NA	mr1178	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216132870	NA	6.45E-10	mr1178	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216132870	NA	6.35E-07	mr1308	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216132870	7.80E-08	NA	mr1334	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216132870	NA	4.96E-18	mr1334	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216132870	NA	1.67E-07	mr1364	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216132870	2.85E-08	NA	mr1390	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216132870	NA	6.24E-11	mr1390	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216132870	NA	3.71E-07	mr1443	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216132870	9.55E-07	NA	mr1489	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216132870	7.16E-09	2.83E-51	mr1490	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216132870	NA	2.61E-11	mr1490	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216132870	1.32E-08	4.55E-62	mr1491	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216132870	NA	7.17E-08	mr1551	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216132870	NA	5.67E-06	mr1884	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216132870	2.71E-06	NA	mr1019_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216132870	NA	2.02E-11	mr1019_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216132870	1.26E-07	NA	mr1055_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216132870	2.33E-06	NA	mr1132_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216132870	6.73E-06	6.39E-16	mr1132_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216132870	1.28E-07	NA	mr1178_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216132870	3.42E-06	6.03E-17	mr1178_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216132870	NA	1.37E-08	mr1261_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216132870	1.29E-06	3.34E-22	mr1334_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216132870	NA	4.59E-14	mr1390_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216132870	NA	1.91E-06	mr1422_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216132870	5.16E-06	1.04E-14	mr1490_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216132870	NA	3.92E-16	mr1732_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216132870	NA	2.00E-08	mr1991_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251