\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1216127501:

Variant ID: vg1216127501 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 16127501
Reference Allele: CAlternative Allele: A,T
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAAACTATATATATGTAGATCAATTTGGAATGGATGGAGTATTTTACACTTCTGCTTCCTCTAGCTGGAATCAGATGTGCACGAAGGCATGGGAGCATGG[C/A,T]
TATGTTTGTGCGATCAATGTGTTTTGTGAGATCCATCACAAGTGAGAATAATATTTTCTGCCGAACAGTTTCATCTGTTTCTTATGCTAAAGAGACTGCA

Reverse complement sequence

TGCAGTCTCTTTAGCATAAGAAACAGATGAAACTGTTCGGCAGAAAATATTATTCTCACTTGTGATGGATCTCACAAAACACATTGATCGCACAAACATA[G/T,A]
CCATGCTCCCATGCCTTCGTGCACATCTGATTCCAGCTAGAGGAAGCAGAAGTGTAAAATACTCCATCCATTCCAAATTGATCTACATATATATAGTTTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 57.50% 8.10% 0.66% 33.62% T: 0.13%
All Indica  2759 47.30% 5.10% 0.87% 46.50% T: 0.22%
All Japonica  1512 78.40% 15.30% 0.26% 6.08% NA
Aus  269 27.50% 0.70% 0.37% 71.38% NA
Indica I  595 46.10% 0.00% 1.51% 52.44% NA
Indica II  465 28.80% 17.40% 1.51% 52.26% NA
Indica III  913 59.70% 3.30% 0.11% 36.80% T: 0.11%
Indica Intermediate  786 44.80% 3.80% 0.89% 49.87% T: 0.64%
Temperate Japonica  767 96.30% 1.20% 0.13% 2.35% NA
Tropical Japonica  504 49.20% 39.30% 0.20% 11.31% NA
Japonica Intermediate  241 82.20% 10.00% 0.83% 7.05% NA
VI/Aromatic  96 86.50% 4.20% 0.00% 9.38% NA
Intermediate  90 76.70% 6.70% 2.22% 14.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1216127501 C -> DEL N N silent_mutation Average:30.782; most accessible tissue: Callus, score: 67.214 N N N N
vg1216127501 C -> A LOC_Os12g27400.1 downstream_gene_variant ; 1863.0bp to feature; MODIFIER silent_mutation Average:30.782; most accessible tissue: Callus, score: 67.214 N N N N
vg1216127501 C -> A LOC_Os12g27390-LOC_Os12g27400 intergenic_region ; MODIFIER silent_mutation Average:30.782; most accessible tissue: Callus, score: 67.214 N N N N
vg1216127501 C -> T LOC_Os12g27400.1 downstream_gene_variant ; 1863.0bp to feature; MODIFIER silent_mutation Average:30.782; most accessible tissue: Callus, score: 67.214 N N N N
vg1216127501 C -> T LOC_Os12g27390-LOC_Os12g27400 intergenic_region ; MODIFIER silent_mutation Average:30.782; most accessible tissue: Callus, score: 67.214 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1216127501 9.29E-08 6.78E-12 mr1016 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216127501 1.14E-08 1.25E-12 mr1017 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216127501 7.62E-06 NA mr1018 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216127501 2.20E-06 1.20E-09 mr1018 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216127501 6.18E-07 NA mr1019 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216127501 2.04E-08 7.03E-13 mr1019 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216127501 1.30E-06 NA mr1023 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216127501 5.97E-06 NA mr1023 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216127501 2.98E-06 NA mr1055 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216127501 4.41E-09 3.38E-13 mr1055 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216127501 NA 4.22E-06 mr1083 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216127501 3.63E-06 NA mr1132 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216127501 9.89E-09 1.33E-12 mr1132 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216127501 NA 2.21E-07 mr1364 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216127501 9.33E-07 NA mr1390 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216127501 NA 1.98E-06 mr1443 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216127501 1.14E-06 NA mr1489 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216127501 2.41E-06 NA mr1490 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216127501 NA 3.65E-07 mr1653 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216127501 6.25E-06 NA mr1778 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216127501 3.36E-06 NA mr1778 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216127501 1.90E-06 1.67E-09 mr1019_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216127501 4.92E-06 NA mr1023_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216127501 1.33E-09 5.89E-12 mr1055_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216127501 2.25E-09 NA mr1132_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216127501 1.82E-06 NA mr1178_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216127501 2.14E-06 4.37E-09 mr1261_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216127501 2.26E-07 NA mr1390_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216127501 4.93E-09 NA mr1490_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251