\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1216127459:

Variant ID: vg1216127459 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 16127459
Reference Allele: CAlternative Allele: G
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GAATAAACCTAATGAATGAACACAAATAGAAATAATCCAAAAAAAACTATATATATGTAGATCAATTTGGAATGGATGGAGTATTTTACACTTCTGCTTC[C/G]
TCTAGCTGGAATCAGATGTGCACGAAGGCATGGGAGCATGGCTATGTTTGTGCGATCAATGTGTTTTGTGAGATCCATCACAAGTGAGAATAATATTTTC

Reverse complement sequence

GAAAATATTATTCTCACTTGTGATGGATCTCACAAAACACATTGATCGCACAAACATAGCCATGCTCCCATGCCTTCGTGCACATCTGATTCCAGCTAGA[G/C]
GAAGCAGAAGTGTAAAATACTCCATCCATTCCAAATTGATCTACATATATATAGTTTTTTTTGGATTATTTCTATTTGTGTTCATTCATTAGGTTTATTC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 55.80% 9.50% 0.49% 34.24% NA
All Indica  2759 44.60% 7.40% 0.76% 47.23% NA
All Japonica  1512 78.10% 15.40% 0.07% 6.42% NA
Aus  269 27.10% 0.40% 0.00% 72.49% NA
Indica I  595 40.50% 4.20% 0.67% 54.62% NA
Indica II  465 26.90% 18.90% 1.29% 52.90% NA
Indica III  913 57.30% 5.50% 0.33% 36.91% NA
Indica Intermediate  786 43.50% 5.20% 1.02% 50.25% NA
Temperate Japonica  767 96.10% 1.20% 0.00% 2.74% NA
Tropical Japonica  504 48.60% 39.70% 0.20% 11.51% NA
Japonica Intermediate  241 82.60% 10.00% 0.00% 7.47% NA
VI/Aromatic  96 85.40% 4.20% 0.00% 10.42% NA
Intermediate  90 75.60% 8.90% 1.11% 14.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1216127459 C -> DEL N N silent_mutation Average:27.549; most accessible tissue: Callus, score: 67.214 N N N N
vg1216127459 C -> G LOC_Os12g27400.1 downstream_gene_variant ; 1905.0bp to feature; MODIFIER silent_mutation Average:27.549; most accessible tissue: Callus, score: 67.214 N N N N
vg1216127459 C -> G LOC_Os12g27390-LOC_Os12g27400 intergenic_region ; MODIFIER silent_mutation Average:27.549; most accessible tissue: Callus, score: 67.214 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1216127459 9.29E-08 6.78E-12 mr1016 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216127459 1.14E-08 1.25E-12 mr1017 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216127459 2.20E-06 1.20E-09 mr1018 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216127459 1.52E-06 NA mr1019 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216127459 2.04E-08 7.03E-13 mr1019 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216127459 3.12E-06 NA mr1023 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216127459 5.97E-06 NA mr1023 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216127459 4.41E-09 3.38E-13 mr1055 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216127459 NA 4.22E-06 mr1083 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216127459 9.89E-09 1.33E-12 mr1132 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216127459 NA 2.21E-07 mr1364 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216127459 9.33E-07 NA mr1390 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216127459 NA 1.98E-06 mr1443 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216127459 2.32E-06 NA mr1489 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216127459 2.41E-06 NA mr1490 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216127459 NA 3.65E-07 mr1653 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216127459 1.49E-06 NA mr1778 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216127459 3.36E-06 NA mr1778 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216127459 3.59E-06 NA mr1019_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216127459 1.90E-06 1.67E-09 mr1019_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216127459 4.92E-06 NA mr1023_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216127459 1.33E-09 5.89E-12 mr1055_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216127459 1.92E-06 NA mr1132_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216127459 2.25E-09 NA mr1132_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216127459 1.82E-06 NA mr1178_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216127459 2.14E-06 4.37E-09 mr1261_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216127459 2.26E-07 NA mr1390_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216127459 4.93E-09 NA mr1490_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251