\
| Variant ID: vg1216127459 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 16127459 |
| Reference Allele: C | Alternative Allele: G |
| Primary Allele: C | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
GAATAAACCTAATGAATGAACACAAATAGAAATAATCCAAAAAAAACTATATATATGTAGATCAATTTGGAATGGATGGAGTATTTTACACTTCTGCTTC[C/G]
TCTAGCTGGAATCAGATGTGCACGAAGGCATGGGAGCATGGCTATGTTTGTGCGATCAATGTGTTTTGTGAGATCCATCACAAGTGAGAATAATATTTTC
GAAAATATTATTCTCACTTGTGATGGATCTCACAAAACACATTGATCGCACAAACATAGCCATGCTCCCATGCCTTCGTGCACATCTGATTCCAGCTAGA[G/C]
GAAGCAGAAGTGTAAAATACTCCATCCATTCCAAATTGATCTACATATATATAGTTTTTTTTGGATTATTTCTATTTGTGTTCATTCATTAGGTTTATTC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 55.80% | 9.50% | 0.49% | 34.24% | NA |
| All Indica | 2759 | 44.60% | 7.40% | 0.76% | 47.23% | NA |
| All Japonica | 1512 | 78.10% | 15.40% | 0.07% | 6.42% | NA |
| Aus | 269 | 27.10% | 0.40% | 0.00% | 72.49% | NA |
| Indica I | 595 | 40.50% | 4.20% | 0.67% | 54.62% | NA |
| Indica II | 465 | 26.90% | 18.90% | 1.29% | 52.90% | NA |
| Indica III | 913 | 57.30% | 5.50% | 0.33% | 36.91% | NA |
| Indica Intermediate | 786 | 43.50% | 5.20% | 1.02% | 50.25% | NA |
| Temperate Japonica | 767 | 96.10% | 1.20% | 0.00% | 2.74% | NA |
| Tropical Japonica | 504 | 48.60% | 39.70% | 0.20% | 11.51% | NA |
| Japonica Intermediate | 241 | 82.60% | 10.00% | 0.00% | 7.47% | NA |
| VI/Aromatic | 96 | 85.40% | 4.20% | 0.00% | 10.42% | NA |
| Intermediate | 90 | 75.60% | 8.90% | 1.11% | 14.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1216127459 | C -> DEL | N | N | silent_mutation | Average:27.549; most accessible tissue: Callus, score: 67.214 | N | N | N | N |
| vg1216127459 | C -> G | LOC_Os12g27400.1 | downstream_gene_variant ; 1905.0bp to feature; MODIFIER | silent_mutation | Average:27.549; most accessible tissue: Callus, score: 67.214 | N | N | N | N |
| vg1216127459 | C -> G | LOC_Os12g27390-LOC_Os12g27400 | intergenic_region ; MODIFIER | silent_mutation | Average:27.549; most accessible tissue: Callus, score: 67.214 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1216127459 | 9.29E-08 | 6.78E-12 | mr1016 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216127459 | 1.14E-08 | 1.25E-12 | mr1017 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216127459 | 2.20E-06 | 1.20E-09 | mr1018 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216127459 | 1.52E-06 | NA | mr1019 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216127459 | 2.04E-08 | 7.03E-13 | mr1019 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216127459 | 3.12E-06 | NA | mr1023 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216127459 | 5.97E-06 | NA | mr1023 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216127459 | 4.41E-09 | 3.38E-13 | mr1055 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216127459 | NA | 4.22E-06 | mr1083 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216127459 | 9.89E-09 | 1.33E-12 | mr1132 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216127459 | NA | 2.21E-07 | mr1364 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216127459 | 9.33E-07 | NA | mr1390 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216127459 | NA | 1.98E-06 | mr1443 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216127459 | 2.32E-06 | NA | mr1489 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216127459 | 2.41E-06 | NA | mr1490 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216127459 | NA | 3.65E-07 | mr1653 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216127459 | 1.49E-06 | NA | mr1778 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216127459 | 3.36E-06 | NA | mr1778 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216127459 | 3.59E-06 | NA | mr1019_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216127459 | 1.90E-06 | 1.67E-09 | mr1019_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216127459 | 4.92E-06 | NA | mr1023_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216127459 | 1.33E-09 | 5.89E-12 | mr1055_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216127459 | 1.92E-06 | NA | mr1132_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216127459 | 2.25E-09 | NA | mr1132_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216127459 | 1.82E-06 | NA | mr1178_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216127459 | 2.14E-06 | 4.37E-09 | mr1261_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216127459 | 2.26E-07 | NA | mr1390_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216127459 | 4.93E-09 | NA | mr1490_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |