Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1216124169:

Variant ID: vg1216124169 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 16124169
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, A: 0.01, others allele: 0.00, population size: 86. )

Flanking Sequence (100 bp) in Reference Genome:


TATCAAATGAGGAACTTTTTAAATTTATCATTTGGAAATTACTACGCGCTTCCATCCTTGTGGTGCAGAAATTGGGTCTCGATACAAGTGAAATTCTACC[C/A]
CACGTCTTCAAAGCTCTCACTGACGAGTTTTGCGGGTTCATCCATCATCATGTCATAGACCCAACTGGTGAATACAACATCAACAAGGTCCCACAACGAG

Reverse complement sequence

CTCGTTGTGGGACCTTGTTGATGTTGTATTCACCAGTTGGGTCTATGACATGATGATGGATGAACCCGCAAAACTCGTCAGTGAGAGCTTTGAAGACGTG[G/T]
GGTAGAATTTCACTTGTATCGAGACCCAATTTCTGCACCACAAGGATGGAAGCGCGTAGTAATTTCCAAATGATAAATTTAAAAAGTTCCTCATTTGATA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 30.20% 0.40% 0.59% 68.83% NA
All Indica  2759 8.80% 0.70% 0.87% 89.63% NA
All Japonica  1512 65.30% 0.10% 0.07% 34.52% NA
Aus  269 24.50% 0.00% 0.00% 75.46% NA
Indica I  595 14.80% 0.30% 1.51% 83.36% NA
Indica II  465 9.90% 1.30% 1.51% 87.31% NA
Indica III  913 2.30% 0.70% 0.44% 96.60% NA
Indica Intermediate  786 11.20% 0.60% 0.51% 87.66% NA
Temperate Japonica  767 95.80% 0.00% 0.00% 4.17% NA
Tropical Japonica  504 14.10% 0.00% 0.20% 85.71% NA
Japonica Intermediate  241 75.50% 0.40% 0.00% 24.07% NA
VI/Aromatic  96 82.30% 0.00% 1.04% 16.67% NA
Intermediate  90 54.40% 0.00% 2.22% 43.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1216124169 C -> DEL N N silent_mutation Average:8.49; most accessible tissue: Callus, score: 20.362 N N N N
vg1216124169 C -> A LOC_Os12g27390-LOC_Os12g27400 intergenic_region ; MODIFIER silent_mutation Average:8.49; most accessible tissue: Callus, score: 20.362 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1216124169 NA 6.63E-09 mr1005 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216124169 6.21E-07 NA mr1016 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216124169 NA 4.15E-11 mr1016 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216124169 2.18E-06 1.60E-34 mr1017 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216124169 NA 4.78E-11 mr1017 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216124169 3.30E-06 NA mr1022 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216124169 1.23E-06 9.03E-34 mr1055 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216124169 NA 5.41E-11 mr1055 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216124169 NA 9.86E-11 mr1132 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216124169 NA 9.33E-06 mr1215 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216124169 NA 8.96E-17 mr1308 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216124169 2.06E-07 NA mr1334 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216124169 NA 3.88E-14 mr1334 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216124169 NA 1.91E-09 mr1364 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216124169 NA 1.32E-15 mr1376 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216124169 NA 7.75E-12 mr1386 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216124169 NA 6.11E-07 mr1424 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216124169 NA 1.32E-15 mr1431 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216124169 NA 1.40E-08 mr1443 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216124169 NA 8.33E-07 mr1584 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216124169 NA 2.39E-07 mr1750 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216124169 NA 2.35E-06 mr1884 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216124169 1.61E-06 1.61E-06 mr1987 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216124169 1.01E-06 NA mr1055_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216124169 1.05E-07 NA mr1178_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216124169 NA 3.98E-15 mr1178_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216124169 NA 6.33E-06 mr1211_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216124169 NA 9.91E-17 mr1334_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216124169 NA 2.11E-10 mr1771_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216124169 NA 1.18E-07 mr1991_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251