Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1216110511:

Variant ID: vg1216110511 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 16110511
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GCATGCTACAGAGATTATAACAACAGTACAATGCTATTTCACATTGTTCACAACACAATAACATACTGTTTAACGATAACAACGAAATTCATTGAAATTA[T/C]
AACATATGAGTACTTGGTACGACAACATTAGGATACAATACTCAATAATTCGCAATACATGACTACTAATTTCATCACATTACATGACATAAATACTTAG

Reverse complement sequence

CTAAGTATTTATGTCATGTAATGTGATGAAATTAGTAGTCATGTATTGCGAATTATTGAGTATTGTATCCTAATGTTGTCGTACCAAGTACTCATATGTT[A/G]
TAATTTCAATGAATTTCGTTGTTATCGTTAAACAGTATGTTATTGTGTTGTGAACAATGTGAAATAGCATTGTACTGTTGTTATAATCTCTGTAGCATGC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	28.30%	2.60%	21.43%	47.69%	NA
All Indica	2759	9.00%	1.00%	35.70%	54.30%	NA
All Japonica	1512	65.10%	0.50%	0.46%	33.93%	NA
Aus	269	13.40%	10.80%	1.49%	74.35%	NA
Indica I	595	17.00%	0.20%	4.03%	78.82%	NA
Indica II	465	11.20%	0.90%	73.98%	13.98%	NA
Indica III	913	1.40%	1.40%	40.53%	56.63%	NA
Indica Intermediate	786	10.60%	1.10%	31.42%	56.87%	NA
Temperate Japonica	767	95.60%	0.00%	0.00%	4.43%	NA
Tropical Japonica	504	14.70%	0.60%	1.19%	83.53%	NA
Japonica Intermediate	241	73.90%	1.70%	0.41%	24.07%	NA
VI/Aromatic	96	28.10%	54.20%	0.00%	17.71%	NA
Intermediate	90	43.30%	8.90%	18.89%	28.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1216110511	T -> C	LOC_Os12g27390.1	intron_variant ; MODIFIER	silent_mutation	Average:24.087; most accessible tissue: Minghui63 young leaf, score: 56.213	N	N	N	N
vg1216110511	T -> DEL	N	N	silent_mutation	Average:24.087; most accessible tissue: Minghui63 young leaf, score: 56.213	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1216110511	NA	9.98E-06	mr1285	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216110511	NA	6.77E-09	mr1746	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216110511	NA	2.57E-06	mr1748	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216110511	NA	2.34E-07	mr1041_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216110511	NA	7.68E-06	mr1184_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216110511	1.30E-06	NA	mr1186_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216110511	NA	4.41E-06	mr1278_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216110511	NA	9.20E-06	mr1284_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216110511	6.22E-06	1.03E-08	mr1293_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216110511	NA	1.85E-06	mr1294_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216110511	NA	2.78E-07	mr1329_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216110511	2.69E-08	3.75E-11	mr1369_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216110511	6.29E-08	4.13E-11	mr1453_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216110511	NA	6.63E-07	mr1497_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216110511	NA	3.65E-07	mr1508_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216110511	NA	3.87E-07	mr1524_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216110511	NA	1.76E-07	mr1604_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216110511	3.89E-07	2.05E-07	mr1616_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216110511	2.01E-07	1.57E-08	mr1652_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216110511	2.36E-06	NA	mr1657_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216110511	NA	2.45E-08	mr1683_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216110511	NA	2.23E-08	mr1690_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216110511	NA	5.90E-07	mr1824_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216110511	NA	1.12E-09	mr1851_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251