Variant ID: vg1216106203 (JBrowse) | Variation Type: SNP |
Chromosome: chr12 | Position: 16106203 |
Reference Allele: A | Alternative Allele: C |
Primary Allele: A | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
GATAGGATAGTAATAATAAGCAGATTCTACTTAAATTTGGAATTTGTTATACGTACAGCAAAATTGTCATCTACATTAGGGTAGACAAAGTATCTCCTAC[A/C]
AATTGTTTGTTCTGCAAACGAGGTAGCCACTTGGCAGCGATCTCTACAACCACACTTTGGACGCTCCGACCATTTAGGTAAACCTAATGGATTGTTCCTC
GAGGAACAATCCATTAGGTTTACCTAAATGGTCGGAGCGTCCAAAGTGTGGTTGTAGAGATCGCTGCCAAGTGGCTACCTCGTTTGCAGAACAAACAATT[T/G]
GTAGGAGATACTTTGTCTACCCTAATGTAGATGACAATTTTGCTGTACGTATAACAAATTCCAAATTTAAGTAGAATCTGCTTATTATTACTATCCTATC
Populations | Population Size | Frequency of A(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 32.20% | 25.10% | 6.33% | 36.35% | NA |
All Indica | 2759 | 12.20% | 34.30% | 9.97% | 43.60% | NA |
All Japonica | 1512 | 65.50% | 6.20% | 0.86% | 27.45% | NA |
Aus | 269 | 24.90% | 50.90% | 0.74% | 23.42% | NA |
Indica I | 595 | 25.70% | 9.20% | 11.26% | 53.78% | NA |
Indica II | 465 | 10.80% | 22.60% | 12.26% | 54.41% | NA |
Indica III | 913 | 3.30% | 56.40% | 6.46% | 33.84% | NA |
Indica Intermediate | 786 | 13.10% | 34.40% | 11.70% | 40.84% | NA |
Temperate Japonica | 767 | 95.70% | 0.00% | 0.13% | 4.17% | NA |
Tropical Japonica | 504 | 14.90% | 16.90% | 1.59% | 66.67% | NA |
Japonica Intermediate | 241 | 75.50% | 3.30% | 1.66% | 19.50% | NA |
VI/Aromatic | 96 | 82.30% | 1.00% | 3.12% | 13.54% | NA |
Intermediate | 90 | 53.30% | 13.30% | 6.67% | 26.67% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg1216106203 | A -> C | LOC_Os12g27370.1 | downstream_gene_variant ; 3379.0bp to feature; MODIFIER | silent_mutation | Average:12.552; most accessible tissue: Callus, score: 30.416 | N | N | N | N |
vg1216106203 | A -> C | LOC_Os12g27390.1 | intron_variant ; MODIFIER | silent_mutation | Average:12.552; most accessible tissue: Callus, score: 30.416 | N | N | N | N |
vg1216106203 | A -> DEL | N | N | silent_mutation | Average:12.552; most accessible tissue: Callus, score: 30.416 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg1216106203 | 3.39E-06 | 4.75E-06 | mr1173 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1216106203 | NA | 8.10E-07 | mr1850 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |