\
| Variant ID: vg1216085140 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 16085140 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
AAACTTGTGTTGTATGGAGTGTTCGCAATGAAGTTATATGCTATGTTAATTTGTTTTCCAAACATGGTCACACGATTCATAAATAATCTAACGTGCAATA[T/C]
TACCGGTAGTAAAATCCATTTAAAGATGAATTTTGTTATTGATTGCCAAACACAATATGGTCGTGTTAATTGAAAGCTGGAGTAGTAGCATATACATGAA
TTCATGTATATGCTACTACTCCAGCTTTCAATTAACACGACCATATTGTGTTTGGCAATCAATAACAAAATTCATCTTTAAATGGATTTTACTACCGGTA[A/G]
TATTGCACGTTAGATTATTTATGAATCGTGTGACCATGTTTGGAAAACAAATTAACATAGCATATAACTTCATTGCGAACACTCCATACAACACAAGTTT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 29.00% | 8.40% | 8.13% | 54.49% | NA |
| All Indica | 2759 | 7.30% | 13.70% | 13.01% | 65.97% | NA |
| All Japonica | 1512 | 64.90% | 0.10% | 0.66% | 34.33% | NA |
| Aus | 269 | 23.40% | 2.60% | 3.35% | 70.63% | NA |
| Indica I | 595 | 11.60% | 10.10% | 5.55% | 72.77% | NA |
| Indica II | 465 | 8.40% | 26.50% | 21.29% | 43.87% | NA |
| Indica III | 913 | 2.30% | 12.30% | 16.32% | 69.11% | NA |
| Indica Intermediate | 786 | 9.20% | 10.70% | 9.92% | 70.23% | NA |
| Temperate Japonica | 767 | 95.70% | 0.00% | 0.00% | 4.30% | NA |
| Tropical Japonica | 504 | 13.50% | 0.20% | 1.59% | 84.72% | NA |
| Japonica Intermediate | 241 | 74.70% | 0.00% | 0.83% | 24.48% | NA |
| VI/Aromatic | 96 | 82.30% | 0.00% | 0.00% | 17.71% | NA |
| Intermediate | 90 | 48.90% | 12.20% | 6.67% | 32.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1216085140 | T -> C | LOC_Os12g27350.1 | upstream_gene_variant ; 3085.0bp to feature; MODIFIER | silent_mutation | Average:19.104; most accessible tissue: Callus, score: 27.107 | N | N | N | N |
| vg1216085140 | T -> C | LOC_Os12g27350-LOC_Os12g27370 | intergenic_region ; MODIFIER | silent_mutation | Average:19.104; most accessible tissue: Callus, score: 27.107 | N | N | N | N |
| vg1216085140 | T -> DEL | N | N | silent_mutation | Average:19.104; most accessible tissue: Callus, score: 27.107 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1216085140 | NA | 7.20E-06 | mr1083 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216085140 | NA | 4.15E-06 | mr1216 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216085140 | NA | 3.68E-06 | mr1304 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216085140 | NA | 9.64E-06 | mr1382 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216085140 | NA | 2.13E-08 | mr1551 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216085140 | NA | 4.00E-08 | mr1696 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216085140 | NA | 2.53E-07 | mr1047_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216085140 | NA | 7.33E-10 | mr1543_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216085140 | NA | 8.74E-06 | mr1815_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |