\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1216085140:

Variant ID: vg1216085140 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 16085140
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAACTTGTGTTGTATGGAGTGTTCGCAATGAAGTTATATGCTATGTTAATTTGTTTTCCAAACATGGTCACACGATTCATAAATAATCTAACGTGCAATA[T/C]
TACCGGTAGTAAAATCCATTTAAAGATGAATTTTGTTATTGATTGCCAAACACAATATGGTCGTGTTAATTGAAAGCTGGAGTAGTAGCATATACATGAA

Reverse complement sequence

TTCATGTATATGCTACTACTCCAGCTTTCAATTAACACGACCATATTGTGTTTGGCAATCAATAACAAAATTCATCTTTAAATGGATTTTACTACCGGTA[A/G]
TATTGCACGTTAGATTATTTATGAATCGTGTGACCATGTTTGGAAAACAAATTAACATAGCATATAACTTCATTGCGAACACTCCATACAACACAAGTTT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 29.00% 8.40% 8.13% 54.49% NA
All Indica  2759 7.30% 13.70% 13.01% 65.97% NA
All Japonica  1512 64.90% 0.10% 0.66% 34.33% NA
Aus  269 23.40% 2.60% 3.35% 70.63% NA
Indica I  595 11.60% 10.10% 5.55% 72.77% NA
Indica II  465 8.40% 26.50% 21.29% 43.87% NA
Indica III  913 2.30% 12.30% 16.32% 69.11% NA
Indica Intermediate  786 9.20% 10.70% 9.92% 70.23% NA
Temperate Japonica  767 95.70% 0.00% 0.00% 4.30% NA
Tropical Japonica  504 13.50% 0.20% 1.59% 84.72% NA
Japonica Intermediate  241 74.70% 0.00% 0.83% 24.48% NA
VI/Aromatic  96 82.30% 0.00% 0.00% 17.71% NA
Intermediate  90 48.90% 12.20% 6.67% 32.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1216085140 T -> C LOC_Os12g27350.1 upstream_gene_variant ; 3085.0bp to feature; MODIFIER silent_mutation Average:19.104; most accessible tissue: Callus, score: 27.107 N N N N
vg1216085140 T -> C LOC_Os12g27350-LOC_Os12g27370 intergenic_region ; MODIFIER silent_mutation Average:19.104; most accessible tissue: Callus, score: 27.107 N N N N
vg1216085140 T -> DEL N N silent_mutation Average:19.104; most accessible tissue: Callus, score: 27.107 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1216085140 NA 7.20E-06 mr1083 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216085140 NA 4.15E-06 mr1216 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216085140 NA 3.68E-06 mr1304 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216085140 NA 9.64E-06 mr1382 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216085140 NA 2.13E-08 mr1551 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216085140 NA 4.00E-08 mr1696 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216085140 NA 2.53E-07 mr1047_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216085140 NA 7.33E-10 mr1543_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216085140 NA 8.74E-06 mr1815_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251