Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1216085140:

Variant ID: vg1216085140 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 16085140
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AAACTTGTGTTGTATGGAGTGTTCGCAATGAAGTTATATGCTATGTTAATTTGTTTTCCAAACATGGTCACACGATTCATAAATAATCTAACGTGCAATA[T/C]
TACCGGTAGTAAAATCCATTTAAAGATGAATTTTGTTATTGATTGCCAAACACAATATGGTCGTGTTAATTGAAAGCTGGAGTAGTAGCATATACATGAA

Reverse complement sequence

TTCATGTATATGCTACTACTCCAGCTTTCAATTAACACGACCATATTGTGTTTGGCAATCAATAACAAAATTCATCTTTAAATGGATTTTACTACCGGTA[A/G]
TATTGCACGTTAGATTATTTATGAATCGTGTGACCATGTTTGGAAAACAAATTAACATAGCATATAACTTCATTGCGAACACTCCATACAACACAAGTTT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	29.00%	8.40%	8.13%	54.49%	NA
All Indica	2759	7.30%	13.70%	13.01%	65.97%	NA
All Japonica	1512	64.90%	0.10%	0.66%	34.33%	NA
Aus	269	23.40%	2.60%	3.35%	70.63%	NA
Indica I	595	11.60%	10.10%	5.55%	72.77%	NA
Indica II	465	8.40%	26.50%	21.29%	43.87%	NA
Indica III	913	2.30%	12.30%	16.32%	69.11%	NA
Indica Intermediate	786	9.20%	10.70%	9.92%	70.23%	NA
Temperate Japonica	767	95.70%	0.00%	0.00%	4.30%	NA
Tropical Japonica	504	13.50%	0.20%	1.59%	84.72%	NA
Japonica Intermediate	241	74.70%	0.00%	0.83%	24.48%	NA
VI/Aromatic	96	82.30%	0.00%	0.00%	17.71%	NA
Intermediate	90	48.90%	12.20%	6.67%	32.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1216085140	T -> C	LOC_Os12g27350.1	upstream_gene_variant ; 3085.0bp to feature; MODIFIER	silent_mutation	Average:19.104; most accessible tissue: Callus, score: 27.107	N	N	N	N
vg1216085140	T -> C	LOC_Os12g27350-LOC_Os12g27370	intergenic_region ; MODIFIER	silent_mutation	Average:19.104; most accessible tissue: Callus, score: 27.107	N	N	N	N
vg1216085140	T -> DEL	N	N	silent_mutation	Average:19.104; most accessible tissue: Callus, score: 27.107	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1216085140	NA	7.20E-06	mr1083	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216085140	NA	4.15E-06	mr1216	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216085140	NA	3.68E-06	mr1304	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216085140	NA	9.64E-06	mr1382	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216085140	NA	2.13E-08	mr1551	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216085140	NA	4.00E-08	mr1696	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216085140	NA	2.53E-07	mr1047_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216085140	NA	7.33E-10	mr1543_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216085140	NA	8.74E-06	mr1815_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251