\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1216081981:

Variant ID: vg1216081981 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 16081981
Reference Allele: AAlternative Allele: C
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.78, A: 0.22, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:


GGTGGTGGCCGTCGTCATCATCGACCGCACGGAAGAACTCGAGGCATGGCTGGATGTAGCGCAGAAACCAGTCGTTGTCTAGGTCGGACAGCGGCTTGGT[A/C]
TCTCTCGGCGTCGCTCGCGCCGGTGCTACCAGCTCCGGATTCCTCCTACGCACCACGAACGAATCCTGCTTCATGGTTGTTATTCTATGTATGTACGTTT

Reverse complement sequence

AAACGTACATACATAGAATAACAACCATGAAGCAGGATTCGTTCGTGGTGCGTAGGAGGAATCCGGAGCTGGTAGCACCGGCGCGAGCGACGCCGAGAGA[T/G]
ACCAAGCCGCTGTCCGACCTAGACAACGACTGGTTTCTGCGCTACATCCAGCCATGCCTCGAGTTCTTCCGTGCGGTCGATGATGACGACGGCCACCACC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 40.10% 24.30% 0.36% 35.21% NA
All Indica  2759 45.20% 5.50% 0.47% 48.79% NA
All Japonica  1512 33.90% 59.60% 0.00% 6.55% NA
Aus  269 14.50% 12.30% 0.74% 72.49% NA
Indica I  595 35.10% 9.70% 0.17% 54.96% NA
Indica II  465 38.10% 6.90% 1.29% 53.76% NA
Indica III  913 60.70% 0.90% 0.22% 38.23% NA
Indica Intermediate  786 39.10% 7.00% 0.51% 53.44% NA
Temperate Japonica  767 7.70% 89.40% 0.00% 2.87% NA
Tropical Japonica  504 76.60% 11.70% 0.00% 11.71% NA
Japonica Intermediate  241 27.80% 64.70% 0.00% 7.47% NA
VI/Aromatic  96 61.50% 28.10% 0.00% 10.42% NA
Intermediate  90 44.40% 37.80% 2.22% 15.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1216081981 A -> C LOC_Os12g27350.1 missense_variant ; p.Asp25Glu; MODERATE nonsynonymous_codon ; D25E Average:52.958; most accessible tissue: Minghui63 flag leaf, score: 85.836 benign -1.335 TOLERATED 1.00
vg1216081981 A -> DEL LOC_Os12g27350.1 N frameshift_variant Average:52.958; most accessible tissue: Minghui63 flag leaf, score: 85.836 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1216081981 1.19E-06 NA mr1022 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216081981 4.44E-10 NA mr1023 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216081981 NA 1.23E-14 mr1023 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216081981 NA 1.36E-33 mr1055 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216081981 2.41E-07 NA mr1079 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216081981 5.80E-06 NA mr1132 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216081981 1.41E-08 NA mr1142 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216081981 7.50E-06 NA mr1178 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216081981 NA 2.89E-09 mr1275 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216081981 NA 6.44E-10 mr1282 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216081981 NA 4.96E-08 mr1364 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216081981 5.11E-07 NA mr1489 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216081981 4.93E-09 NA mr1491 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216081981 NA 5.11E-07 mr1551 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216081981 NA 5.09E-06 mr1682 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216081981 8.21E-08 NA mr1778 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216081981 8.96E-06 NA mr1907 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216081981 NA 1.48E-11 mr1921 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216081981 NA 1.92E-16 mr1023_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216081981 NA 1.29E-06 mr1623_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216081981 9.45E-06 4.54E-06 mr1717_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216081981 NA 7.75E-14 mr1778_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251