\
| Variant ID: vg1216072989 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 16072989 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
GGTACGTACGTAACCTGCTTACTAACTGGATGTGGCCGCAGGCGTACATACATGTGGTAGATGGGAGGGGGAACTAACTTTTTTTTAATCTAATCTAATC[C/T]
AATGGTCTAAAATAATGGACCCACTGGTTTAAGTGAAAATCGACGGCTAGATGTTTCTAATATATTAAAATGCCACGTGGCAGCATATGAGTTTTTAGGA
TCCTAAAAACTCATATGCTGCCACGTGGCATTTTAATATATTAGAAACATCTAGCCGTCGATTTTCACTTAAACCAGTGGGTCCATTATTTTAGACCATT[G/A]
GATTAGATTAGATTAAAAAAAAGTTAGTTCCCCCTCCCATCTACCACATGTATGTACGCCTGCGGCCACATCCAGTTAGTAAGCAGGTTACGTACGTACC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 35.10% | 2.20% | 13.44% | 49.22% | NA |
| All Indica | 2759 | 17.50% | 3.30% | 21.46% | 57.81% | NA |
| All Japonica | 1512 | 64.70% | 0.30% | 0.53% | 34.39% | NA |
| Aus | 269 | 24.90% | 4.10% | 9.67% | 61.34% | NA |
| Indica I | 595 | 15.50% | 1.00% | 23.70% | 59.83% | NA |
| Indica II | 465 | 36.10% | 1.30% | 4.95% | 57.63% | NA |
| Indica III | 913 | 6.40% | 6.20% | 33.41% | 54.00% | NA |
| Indica Intermediate | 786 | 20.90% | 2.70% | 15.65% | 60.81% | NA |
| Temperate Japonica | 767 | 95.70% | 0.00% | 0.00% | 4.30% | NA |
| Tropical Japonica | 504 | 12.90% | 1.00% | 1.39% | 84.72% | NA |
| Japonica Intermediate | 241 | 74.70% | 0.00% | 0.41% | 24.90% | NA |
| VI/Aromatic | 96 | 82.30% | 0.00% | 3.12% | 14.58% | NA |
| Intermediate | 90 | 57.80% | 0.00% | 6.67% | 35.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1216072989 | C -> DEL | N | N | silent_mutation | Average:31.044; most accessible tissue: Callus, score: 75.404 | N | N | N | N |
| vg1216072989 | C -> T | LOC_Os12g27340.1 | upstream_gene_variant ; 1779.0bp to feature; MODIFIER | silent_mutation | Average:31.044; most accessible tissue: Callus, score: 75.404 | N | N | N | N |
| vg1216072989 | C -> T | LOC_Os12g27335-LOC_Os12g27340 | intergenic_region ; MODIFIER | silent_mutation | Average:31.044; most accessible tissue: Callus, score: 75.404 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1216072989 | 1.42E-10 | 2.29E-15 | mr1016 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216072989 | 7.22E-07 | NA | mr1017 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216072989 | 2.85E-11 | 3.24E-15 | mr1017 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216072989 | 1.03E-08 | 2.74E-12 | mr1018 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216072989 | 1.71E-10 | 5.23E-15 | mr1019 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216072989 | 1.86E-06 | NA | mr1023 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216072989 | 7.02E-12 | 1.48E-16 | mr1055 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216072989 | 9.37E-06 | NA | mr1079 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216072989 | NA | 1.79E-06 | mr1082 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216072989 | NA | 6.19E-09 | mr1083 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216072989 | 7.11E-07 | 7.12E-07 | mr1085 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216072989 | NA | 3.69E-06 | mr1086 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216072989 | 8.72E-11 | 1.82E-15 | mr1132 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216072989 | 2.64E-06 | NA | mr1142 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216072989 | 5.14E-06 | 3.28E-11 | mr1178 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216072989 | 9.94E-06 | 1.36E-06 | mr1196 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216072989 | NA | 1.16E-06 | mr1226 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216072989 | NA | 4.62E-08 | mr1364 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216072989 | 6.48E-09 | 6.67E-13 | mr1390 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216072989 | NA | 2.38E-08 | mr1408 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216072989 | NA | 2.61E-08 | mr1443 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216072989 | 2.47E-06 | NA | mr1489 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216072989 | 1.54E-08 | 8.96E-13 | mr1490 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216072989 | 2.49E-06 | NA | mr1491 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216072989 | 1.15E-06 | NA | mr1778 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216072989 | NA | 2.83E-06 | mr1949 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216072989 | 4.87E-06 | NA | mr1019_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216072989 | 6.61E-07 | 1.11E-10 | mr1019_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216072989 | 6.34E-06 | NA | mr1023_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216072989 | 1.60E-08 | NA | mr1023_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216072989 | 1.45E-07 | NA | mr1055_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216072989 | 1.70E-12 | 2.92E-14 | mr1055_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216072989 | 2.28E-06 | NA | mr1079_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216072989 | NA | 1.19E-07 | mr1083_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216072989 | 4.23E-08 | NA | mr1132_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216072989 | 1.70E-14 | 3.64E-17 | mr1132_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216072989 | 6.87E-06 | NA | mr1178_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216072989 | 2.66E-09 | 3.00E-14 | mr1178_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216072989 | NA | 2.16E-06 | mr1226_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216072989 | 1.84E-06 | 1.95E-09 | mr1261_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216072989 | 8.24E-07 | NA | mr1390_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216072989 | 1.98E-12 | 3.68E-15 | mr1390_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216072989 | NA | 5.79E-06 | mr1408_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216072989 | 9.53E-08 | NA | mr1489_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216072989 | 7.11E-06 | NA | mr1490_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216072989 | 1.82E-13 | 9.60E-16 | mr1490_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216072989 | 4.00E-06 | NA | mr1778_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |