\
| Variant ID: vg1216063848 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 16063848 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
GTGAAAGTAAGAGAAGAGAAGAGAAACCAAATTAAGAAGGAATGAAGAAAAAGAAGAAACAAATGGTGAAAATAAATACCGATAGCTTCTCAAGCAGGTC[G/A]
GTATATTAAAAATTATGCATTAAGCGGAGGTGATTATGGATCGGCCAAATCATTAAGATCTTATAAATTTAAACTCCATCATTGTAGTTTCAGAGCCTAA
TTAGGCTCTGAAACTACAATGATGGAGTTTAAATTTATAAGATCTTAATGATTTGGCCGATCCATAATCACCTCCGCTTAATGCATAATTTTTAATATAC[C/T]
GACCTGCTTGAGAAGCTATCGGTATTTATTTTCACCATTTGTTTCTTCTTTTTCTTCATTCCTTCTTAATTTGGTTTCTCTTCTCTTCTCTTACTTTCAC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 32.70% | 28.20% | 2.43% | 36.61% | NA |
| All Indica | 2759 | 38.30% | 7.10% | 1.96% | 52.66% | NA |
| All Japonica | 1512 | 24.00% | 64.20% | 3.70% | 8.13% | NA |
| Aus | 269 | 33.80% | 19.00% | 0.37% | 46.84% | NA |
| Indica I | 595 | 26.20% | 9.20% | 2.18% | 62.35% | NA |
| Indica II | 465 | 17.40% | 11.00% | 4.73% | 66.88% | NA |
| Indica III | 913 | 60.60% | 2.00% | 0.55% | 36.91% | NA |
| Indica Intermediate | 786 | 34.00% | 9.00% | 1.78% | 55.22% | NA |
| Temperate Japonica | 767 | 1.20% | 95.60% | 0.13% | 3.13% | NA |
| Tropical Japonica | 504 | 62.10% | 11.70% | 10.32% | 15.87% | NA |
| Japonica Intermediate | 241 | 17.00% | 73.90% | 1.24% | 7.88% | NA |
| VI/Aromatic | 96 | 8.30% | 82.30% | 0.00% | 9.38% | NA |
| Intermediate | 90 | 31.10% | 43.30% | 4.44% | 21.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1216063848 | G -> DEL | N | N | silent_mutation | Average:29.624; most accessible tissue: Minghui63 young leaf, score: 63.571 | N | N | N | N |
| vg1216063848 | G -> A | LOC_Os12g27335.1 | downstream_gene_variant ; 1859.0bp to feature; MODIFIER | silent_mutation | Average:29.624; most accessible tissue: Minghui63 young leaf, score: 63.571 | N | N | N | N |
| vg1216063848 | G -> A | LOC_Os12g27335-LOC_Os12g27340 | intergenic_region ; MODIFIER | silent_mutation | Average:29.624; most accessible tissue: Minghui63 young leaf, score: 63.571 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1216063848 | NA | 1.58E-06 | mr1304 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216063848 | 2.39E-06 | 6.19E-12 | mr1364 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216063848 | NA | 4.59E-06 | mr1364 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216063848 | NA | 2.52E-06 | mr1382 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216063848 | NA | 8.17E-06 | mr1414 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216063848 | NA | 8.94E-11 | mr1443 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216063848 | NA | 2.06E-06 | mr1471 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216063848 | NA | 3.78E-08 | mr1551 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216063848 | NA | 8.14E-08 | mr1696 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216063848 | NA | 1.13E-14 | mr1539_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216063848 | NA | 9.74E-14 | mr1732_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |