\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1216063848:

Variant ID: vg1216063848 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 16063848
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GTGAAAGTAAGAGAAGAGAAGAGAAACCAAATTAAGAAGGAATGAAGAAAAAGAAGAAACAAATGGTGAAAATAAATACCGATAGCTTCTCAAGCAGGTC[G/A]
GTATATTAAAAATTATGCATTAAGCGGAGGTGATTATGGATCGGCCAAATCATTAAGATCTTATAAATTTAAACTCCATCATTGTAGTTTCAGAGCCTAA

Reverse complement sequence

TTAGGCTCTGAAACTACAATGATGGAGTTTAAATTTATAAGATCTTAATGATTTGGCCGATCCATAATCACCTCCGCTTAATGCATAATTTTTAATATAC[C/T]
GACCTGCTTGAGAAGCTATCGGTATTTATTTTCACCATTTGTTTCTTCTTTTTCTTCATTCCTTCTTAATTTGGTTTCTCTTCTCTTCTCTTACTTTCAC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 32.70% 28.20% 2.43% 36.61% NA
All Indica  2759 38.30% 7.10% 1.96% 52.66% NA
All Japonica  1512 24.00% 64.20% 3.70% 8.13% NA
Aus  269 33.80% 19.00% 0.37% 46.84% NA
Indica I  595 26.20% 9.20% 2.18% 62.35% NA
Indica II  465 17.40% 11.00% 4.73% 66.88% NA
Indica III  913 60.60% 2.00% 0.55% 36.91% NA
Indica Intermediate  786 34.00% 9.00% 1.78% 55.22% NA
Temperate Japonica  767 1.20% 95.60% 0.13% 3.13% NA
Tropical Japonica  504 62.10% 11.70% 10.32% 15.87% NA
Japonica Intermediate  241 17.00% 73.90% 1.24% 7.88% NA
VI/Aromatic  96 8.30% 82.30% 0.00% 9.38% NA
Intermediate  90 31.10% 43.30% 4.44% 21.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1216063848 G -> DEL N N silent_mutation Average:29.624; most accessible tissue: Minghui63 young leaf, score: 63.571 N N N N
vg1216063848 G -> A LOC_Os12g27335.1 downstream_gene_variant ; 1859.0bp to feature; MODIFIER silent_mutation Average:29.624; most accessible tissue: Minghui63 young leaf, score: 63.571 N N N N
vg1216063848 G -> A LOC_Os12g27335-LOC_Os12g27340 intergenic_region ; MODIFIER silent_mutation Average:29.624; most accessible tissue: Minghui63 young leaf, score: 63.571 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1216063848 NA 1.58E-06 mr1304 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216063848 2.39E-06 6.19E-12 mr1364 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216063848 NA 4.59E-06 mr1364 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216063848 NA 2.52E-06 mr1382 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216063848 NA 8.17E-06 mr1414 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216063848 NA 8.94E-11 mr1443 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216063848 NA 2.06E-06 mr1471 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216063848 NA 3.78E-08 mr1551 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216063848 NA 8.14E-08 mr1696 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216063848 NA 1.13E-14 mr1539_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216063848 NA 9.74E-14 mr1732_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251