\
| Variant ID: vg1216059901 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 16059901 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.95, C: 0.05, others allele: 0.00, population size: 88. )
CTACATACAAGTGACTGAAATTTGTGGGAATTTTCAGCACTGAAAACTACACACCGCAATTGCACTCATGGAGAAACACATACTGGTTCTGGCTGGGAAC[T/C]
AGTCAGAGGTGCCGGTTTCCTAGCTAAAACCAATTTGATGGTACAAATACCGAATACCATAGGTGCACCTGTAGAATTATAGGTATCAGTTATTACATTA
TAATGTAATAACTGATACCTATAATTCTACAGGTGCACCTATGGTATTCGGTATTTGTACCATCAAATTGGTTTTAGCTAGGAAACCGGCACCTCTGACT[A/G]
GTTCCCAGCCAGAACCAGTATGTGTTTCTCCATGAGTGCAATTGCGGTGTGTAGTTTTCAGTGCTGAAAATTCCCACAAATTTCAGTCACTTGTATGTAG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 28.50% | 16.00% | 0.76% | 54.72% | NA |
| All Indica | 2759 | 7.60% | 7.50% | 1.09% | 83.80% | NA |
| All Japonica | 1512 | 64.20% | 28.70% | 0.07% | 7.01% | NA |
| Aus | 269 | 18.60% | 32.30% | 0.37% | 48.70% | NA |
| Indica I | 595 | 9.70% | 8.20% | 1.51% | 80.50% | NA |
| Indica II | 465 | 11.00% | 10.80% | 0.86% | 77.42% | NA |
| Indica III | 913 | 2.50% | 6.80% | 0.55% | 90.14% | NA |
| Indica Intermediate | 786 | 9.90% | 5.90% | 1.53% | 82.70% | NA |
| Temperate Japonica | 767 | 95.60% | 1.40% | 0.00% | 3.00% | NA |
| Tropical Japonica | 504 | 11.70% | 75.60% | 0.20% | 12.50% | NA |
| Japonica Intermediate | 241 | 74.30% | 17.40% | 0.00% | 8.30% | NA |
| VI/Aromatic | 96 | 82.30% | 5.20% | 0.00% | 12.50% | NA |
| Intermediate | 90 | 43.30% | 24.40% | 4.44% | 27.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1216059901 | T -> C | LOC_Os12g27335.1 | upstream_gene_variant ; 1480.0bp to feature; MODIFIER | silent_mutation | Average:38.308; most accessible tissue: Minghui63 young leaf, score: 69.4 | N | N | N | N |
| vg1216059901 | T -> C | LOC_Os12g27330-LOC_Os12g27335 | intergenic_region ; MODIFIER | silent_mutation | Average:38.308; most accessible tissue: Minghui63 young leaf, score: 69.4 | N | N | N | N |
| vg1216059901 | T -> DEL | N | N | silent_mutation | Average:38.308; most accessible tissue: Minghui63 young leaf, score: 69.4 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1216059901 | NA | 1.40E-14 | mr1016 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216059901 | NA | 1.16E-11 | mr1017 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216059901 | NA | 2.43E-15 | mr1022 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216059901 | NA | 4.04E-10 | mr1023 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216059901 | NA | 8.01E-06 | mr1048 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216059901 | NA | 2.92E-13 | mr1055 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216059901 | NA | 3.05E-07 | mr1058 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216059901 | NA | 6.85E-14 | mr1079 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216059901 | NA | 3.77E-11 | mr1132 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216059901 | NA | 3.41E-12 | mr1142 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216059901 | NA | 1.59E-12 | mr1178 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216059901 | 6.85E-06 | NA | mr1217 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216059901 | NA | 3.31E-06 | mr1266 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216059901 | NA | 5.60E-07 | mr1304 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216059901 | NA | 2.76E-07 | mr1345 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216059901 | 9.02E-07 | 3.02E-09 | mr1364 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216059901 | NA | 2.05E-06 | mr1364 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216059901 | NA | 1.88E-07 | mr1382 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216059901 | NA | 4.87E-07 | mr1382 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216059901 | NA | 3.86E-06 | mr1387 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216059901 | NA | 8.46E-14 | mr1390 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216059901 | NA | 4.04E-08 | mr1398 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216059901 | NA | 4.03E-06 | mr1403 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216059901 | NA | 1.84E-06 | mr1408 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216059901 | NA | 1.36E-06 | mr1414 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216059901 | 2.49E-06 | 2.79E-09 | mr1443 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216059901 | NA | 1.70E-06 | mr1443 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216059901 | NA | 6.06E-12 | mr1490 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216059901 | NA | 2.99E-10 | mr1491 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216059901 | 5.04E-06 | 5.19E-15 | mr1546 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216059901 | NA | 2.34E-08 | mr1551 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216059901 | NA | 4.23E-06 | mr1661 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216059901 | NA | 1.16E-09 | mr1696 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216059901 | NA | 5.99E-09 | mr1697 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216059901 | 1.09E-06 | 1.40E-09 | mr1743 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216059901 | NA | 7.70E-06 | mr1743 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216059901 | NA | 2.24E-06 | mr1821 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216059901 | 2.79E-06 | NA | mr1845 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216059901 | NA | 3.39E-17 | mr1022_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216059901 | NA | 2.56E-10 | mr1023_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216059901 | 8.61E-07 | 1.87E-18 | mr1055_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216059901 | NA | 6.44E-17 | mr1079_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216059901 | NA | 2.57E-16 | mr1132_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216059901 | 6.33E-06 | 5.04E-18 | mr1178_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216059901 | 7.59E-06 | 6.33E-16 | mr1390_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216059901 | NA | 7.62E-08 | mr1489_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216059901 | NA | 4.72E-15 | mr1490_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216059901 | NA | 6.06E-06 | mr1577_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216059901 | NA | 2.63E-06 | mr1587_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216059901 | NA | 3.42E-07 | mr1803_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216059901 | NA | 6.12E-06 | mr1815_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |