Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1216059532:

Variant ID: vg1216059532 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 16059532
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GGAGCTGGGAGATAAGGAAGAGGGGTTTGTTAGTCTTAGCGGGACGACTATGTGCGGCCGTCGGACAGCTGATGGGTGGCGGACACAGCAGGTTGGCACC[T/C]
GAGGAGGTGTATTGCTGCGAAAGACGTGGGATTGGAGGAAAGTGACGCACATGGTTGGTAGCGGATCGAGATGTGGAAGTAATAATGGTTAGGACAGGAT

Reverse complement sequence

ATCCTGTCCTAACCATTATTACTTCCACATCTCGATCCGCTACCAACCATGTGCGTCACTTTCCTCCAATCCCACGTCTTTCGCAGCAATACACCTCCTC[A/G]
GGTGCCAACCTGCTGTGTCCGCCACCCATCAGCTGTCCGACGGCCGCACATAGTCGTCCCGCTAAGACTAACAAACCCCTCTTCCTTATCTCCCAGCTCC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 40.20% 4.70% 0.63% 54.46% NA
All Indica  2759 11.10% 4.60% 0.98% 83.36% NA
All Japonica  1512 92.70% 0.30% 0.13% 6.88% NA
Aus  269 18.60% 32.00% 0.00% 49.44% NA
Indica I  595 10.30% 8.10% 1.01% 80.67% NA
Indica II  465 21.10% 1.30% 1.72% 75.91% NA
Indica III  913 5.10% 4.40% 0.55% 89.92% NA
Indica Intermediate  786 12.70% 4.10% 1.02% 82.19% NA
Temperate Japonica  767 96.70% 0.10% 0.13% 3.00% NA
Tropical Japonica  504 87.10% 0.60% 0.20% 12.10% NA
Japonica Intermediate  241 91.30% 0.40% 0.00% 8.30% NA
VI/Aromatic  96 86.50% 1.00% 0.00% 12.50% NA
Intermediate  90 65.60% 5.60% 1.11% 27.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1216059532 T -> C LOC_Os12g27330.1 upstream_gene_variant ; 4635.0bp to feature; MODIFIER silent_mutation Average:45.937; most accessible tissue: Minghui63 young leaf, score: 80.562 N N N N
vg1216059532 T -> C LOC_Os12g27335.1 upstream_gene_variant ; 1849.0bp to feature; MODIFIER silent_mutation Average:45.937; most accessible tissue: Minghui63 young leaf, score: 80.562 N N N N
vg1216059532 T -> C LOC_Os12g27330-LOC_Os12g27335 intergenic_region ; MODIFIER silent_mutation Average:45.937; most accessible tissue: Minghui63 young leaf, score: 80.562 N N N N
vg1216059532 T -> DEL N N silent_mutation Average:45.937; most accessible tissue: Minghui63 young leaf, score: 80.562 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1216059532 2.26E-09 1.13E-14 mr1016 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216059532 5.89E-08 NA mr1017 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216059532 1.82E-10 6.28E-15 mr1017 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216059532 4.24E-07 NA mr1018 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216059532 1.70E-08 2.66E-12 mr1018 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216059532 1.84E-07 NA mr1019 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216059532 8.40E-10 1.66E-14 mr1019 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216059532 1.13E-06 NA mr1023 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216059532 1.71E-06 NA mr1023 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216059532 1.27E-08 NA mr1055 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216059532 7.66E-11 9.64E-16 mr1055 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216059532 NA 4.47E-06 mr1060 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216059532 NA 2.75E-06 mr1060 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216059532 1.39E-07 NA mr1132 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216059532 6.92E-10 1.21E-14 mr1132 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216059532 4.37E-06 NA mr1142 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216059532 NA 1.88E-10 mr1178 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216059532 1.44E-07 9.28E-09 mr1364 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216059532 NA 1.99E-08 mr1364 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216059532 6.03E-08 2.73E-12 mr1390 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216059532 NA 2.28E-06 mr1408 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216059532 1.77E-06 1.12E-07 mr1443 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216059532 NA 9.90E-09 mr1443 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216059532 NA 1.44E-06 mr1485 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216059532 8.33E-08 NA mr1489 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216059532 2.64E-06 NA mr1489 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216059532 7.15E-08 2.29E-12 mr1490 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216059532 NA 1.49E-06 mr1686 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216059532 NA 4.00E-06 mr1743 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216059532 6.56E-07 NA mr1778 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216059532 2.15E-06 NA mr1778 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216059532 8.30E-06 NA mr1845 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216059532 NA 2.61E-06 mr1937 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216059532 7.20E-06 1.65E-08 mr1937 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216059532 3.21E-07 9.22E-11 mr1019_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216059532 7.16E-08 NA mr1023_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216059532 1.72E-07 NA mr1023_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216059532 4.65E-09 NA mr1055_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216059532 3.48E-12 7.75E-15 mr1055_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216059532 5.19E-08 NA mr1132_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216059532 1.14E-11 2.84E-15 mr1132_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216059532 5.48E-09 1.20E-13 mr1178_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216059532 6.47E-07 7.66E-10 mr1261_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216059532 1.85E-06 NA mr1390_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216059532 1.00E-10 2.86E-14 mr1390_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216059532 NA 2.30E-10 mr1458_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216059532 5.45E-07 NA mr1489_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216059532 4.89E-07 NA mr1489_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216059532 6.89E-06 NA mr1490_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216059532 2.76E-12 3.26E-15 mr1490_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251