\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1216039002:

Variant ID: vg1216039002 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 16039002
Reference Allele: AAlternative Allele: T,C
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 89. )

Flanking Sequence (100 bp) in Reference Genome:


GAACTAAGAAAAAAATCCCGCAGCTTATGATGTGGTACCTTCCTGTCAAAGACTGCATTAAACGGATATACTCAAATCCGCGAGATGCGGAACTAATGCG[A/T,C]
TGGCATCAAGAAGGGCGCAAGAAAAATGGGATGATTCGACACCCGGCAGATGCTCGTCAGTGGATAAACTTTGATGCTCAGTACAGAGAGTTTGCTAAAG

Reverse complement sequence

CTTTAGCAAACTCTCTGTACTGAGCATCAAAGTTTATCCACTGACGAGCATCTGCCGGGTGTCGAATCATCCCATTTTTCTTGCGCCCTTCTTGATGCCA[T/A,G]
CGCATTAGTTCCGCATCTCGCGGATTTGAGTATATCCGTTTAATGCAGTCTTTGACAGGAAGGTACCACATCATAAGCTGCGGGATTTTTTTCTTAGTTC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 29.20% 8.50% 2.22% 59.65% C: 0.44%
All Indica  2759 8.30% 12.50% 3.23% 75.39% C: 0.58%
All Japonica  1512 64.60% 0.20% 0.26% 34.85% C: 0.07%
Aus  269 19.00% 20.10% 2.23% 58.36% C: 0.37%
Indica I  595 10.90% 0.30% 1.18% 87.39% C: 0.17%
Indica II  465 11.60% 8.40% 3.23% 76.56% C: 0.22%
Indica III  913 3.00% 24.60% 4.16% 67.03% C: 1.20%
Indica Intermediate  786 10.60% 10.10% 3.69% 75.32% C: 0.38%
Temperate Japonica  767 95.70% 0.00% 0.00% 4.30% NA
Tropical Japonica  504 12.70% 0.60% 0.79% 85.71% C: 0.20%
Japonica Intermediate  241 74.30% 0.00% 0.00% 25.73% NA
VI/Aromatic  96 83.30% 1.00% 1.04% 14.58% NA
Intermediate  90 45.60% 0.00% 5.56% 45.56% C: 3.33%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1216039002 A -> C LOC_Os12g27300.1 upstream_gene_variant ; 196.0bp to feature; MODIFIER silent_mutation Average:9.394; most accessible tissue: Callus, score: 37.731 N N N N
vg1216039002 A -> C LOC_Os12g27290.1 downstream_gene_variant ; 4952.0bp to feature; MODIFIER silent_mutation Average:9.394; most accessible tissue: Callus, score: 37.731 N N N N
vg1216039002 A -> C LOC_Os12g27310.1 downstream_gene_variant ; 3059.0bp to feature; MODIFIER silent_mutation Average:9.394; most accessible tissue: Callus, score: 37.731 N N N N
vg1216039002 A -> C LOC_Os12g27290-LOC_Os12g27300 intergenic_region ; MODIFIER silent_mutation Average:9.394; most accessible tissue: Callus, score: 37.731 N N N N
vg1216039002 A -> DEL N N silent_mutation Average:9.394; most accessible tissue: Callus, score: 37.731 N N N N
vg1216039002 A -> T LOC_Os12g27300.1 upstream_gene_variant ; 196.0bp to feature; MODIFIER silent_mutation Average:9.394; most accessible tissue: Callus, score: 37.731 N N N N
vg1216039002 A -> T LOC_Os12g27290.1 downstream_gene_variant ; 4952.0bp to feature; MODIFIER silent_mutation Average:9.394; most accessible tissue: Callus, score: 37.731 N N N N
vg1216039002 A -> T LOC_Os12g27310.1 downstream_gene_variant ; 3059.0bp to feature; MODIFIER silent_mutation Average:9.394; most accessible tissue: Callus, score: 37.731 N N N N
vg1216039002 A -> T LOC_Os12g27290-LOC_Os12g27300 intergenic_region ; MODIFIER silent_mutation Average:9.394; most accessible tissue: Callus, score: 37.731 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1216039002 NA 1.28E-12 mr1016 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216039002 NA 8.79E-13 mr1017 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216039002 NA 1.65E-12 mr1018 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216039002 NA 2.64E-11 mr1019 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216039002 NA 5.94E-13 mr1055 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216039002 NA 9.03E-14 mr1132 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216039002 NA 1.16E-11 mr1178 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216039002 NA 1.87E-06 mr1209 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216039002 NA 7.48E-07 mr1308 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216039002 NA 8.33E-14 mr1334 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216039002 NA 2.04E-08 mr1364 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216039002 2.02E-06 1.44E-16 mr1376 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216039002 NA 1.09E-06 mr1382 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216039002 NA 5.08E-12 mr1386 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216039002 NA 5.87E-12 mr1390 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216039002 NA 5.98E-16 mr1401 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216039002 NA 3.47E-06 mr1401 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216039002 2.02E-06 1.44E-16 mr1431 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216039002 NA 1.07E-07 mr1443 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216039002 NA 3.08E-06 mr1471 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216039002 NA 1.97E-12 mr1490 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216039002 NA 1.90E-06 mr1511 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216039002 NA 4.15E-06 mr1518 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216039002 NA 2.59E-08 mr1551 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216039002 NA 2.14E-07 mr1606 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216039002 NA 8.01E-07 mr1622 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216039002 NA 2.78E-07 mr1696 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216039002 NA 1.65E-07 mr1926 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216039002 NA 9.13E-13 mr1019_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216039002 NA 1.68E-13 mr1055_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216039002 4.64E-06 1.68E-17 mr1132_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216039002 5.33E-07 4.54E-19 mr1178_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216039002 NA 4.73E-10 mr1261_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216039002 NA 3.70E-08 mr1304_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216039002 NA 4.36E-16 mr1334_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216039002 NA 1.51E-09 mr1364_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216039002 2.92E-06 1.10E-15 mr1390_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216039002 NA 6.51E-06 mr1398_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216039002 1.57E-06 1.77E-16 mr1490_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216039002 NA 1.66E-19 mr1539_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216039002 NA 1.51E-15 mr1539_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216039002 NA 1.36E-19 mr1540_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216039002 NA 2.19E-16 mr1540_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216039002 NA 5.16E-07 mr1551_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216039002 NA 8.28E-06 mr1623_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216039002 NA 2.29E-07 mr1632_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216039002 NA 9.36E-07 mr1653_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216039002 NA 5.05E-09 mr1696_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216039002 NA 6.99E-08 mr1705_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216039002 NA 3.58E-20 mr1732_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216039002 NA 5.49E-15 mr1732_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216039002 NA 9.05E-10 mr1942_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251