\
| Variant ID: vg1216037905 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 16037905 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.92, A: 0.08, others allele: 0.00, population size: 78. )
TATACCCGAGAATTACAAGATACGTCCATAACGGACACGACTACTATCTCTAACAAACTCCAAGATACCATAAGTCTTTGCGGCAAACTTTTGCCCAAGC[A/G]
TATCTCTAATGAAATTACATAAAACATCCTAATTAATAGATACAATTGCCTTCTCAGGACTCTATCCATGTACGGCAATCACCTTGAAGCACCTCAATTC
GAATTGAGGTGCTTCAAGGTGATTGCCGTACATGGATAGAGTCCTGAGAAGGCAATTGTATCTATTAATTAGGATGTTTTATGTAATTTCATTAGAGATA[T/C]
GCTTGGGCAAAAGTTTGCCGCAAAGACTTATGGTATCTTGGAGTTTGTTAGAGATAGTAGTCGTGTCCGTTATGGACGTATCTTGTAATTCTCGGGTATA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 26.10% | 3.90% | 21.75% | 48.24% | NA |
| All Indica | 2759 | 7.30% | 1.50% | 31.82% | 59.41% | NA |
| All Japonica | 1512 | 60.60% | 3.70% | 5.03% | 30.69% | NA |
| Aus | 269 | 19.00% | 10.80% | 22.68% | 47.58% | NA |
| Indica I | 595 | 8.90% | 0.70% | 18.49% | 71.93% | NA |
| Indica II | 465 | 10.30% | 1.30% | 26.24% | 62.15% | NA |
| Indica III | 913 | 1.90% | 1.60% | 45.02% | 51.48% | NA |
| Indica Intermediate | 786 | 10.60% | 2.00% | 29.90% | 57.51% | NA |
| Temperate Japonica | 767 | 91.30% | 3.70% | 0.78% | 4.30% | NA |
| Tropical Japonica | 504 | 12.10% | 0.80% | 13.49% | 73.61% | NA |
| Japonica Intermediate | 241 | 64.30% | 10.00% | 0.83% | 24.90% | NA |
| VI/Aromatic | 96 | 28.10% | 54.20% | 6.25% | 11.46% | NA |
| Intermediate | 90 | 42.20% | 7.80% | 7.78% | 42.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1216037905 | A -> DEL | N | N | silent_mutation | Average:8.56; most accessible tissue: Zhenshan97 root, score: 12.891 | N | N | N | N |
| vg1216037905 | A -> G | LOC_Os12g27300.1 | upstream_gene_variant ; 1293.0bp to feature; MODIFIER | silent_mutation | Average:8.56; most accessible tissue: Zhenshan97 root, score: 12.891 | N | N | N | N |
| vg1216037905 | A -> G | LOC_Os12g27290.1 | downstream_gene_variant ; 3855.0bp to feature; MODIFIER | silent_mutation | Average:8.56; most accessible tissue: Zhenshan97 root, score: 12.891 | N | N | N | N |
| vg1216037905 | A -> G | LOC_Os12g27310.1 | downstream_gene_variant ; 4156.0bp to feature; MODIFIER | silent_mutation | Average:8.56; most accessible tissue: Zhenshan97 root, score: 12.891 | N | N | N | N |
| vg1216037905 | A -> G | LOC_Os12g27290-LOC_Os12g27300 | intergenic_region ; MODIFIER | silent_mutation | Average:8.56; most accessible tissue: Zhenshan97 root, score: 12.891 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1216037905 | NA | 1.28E-07 | mr1057 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216037905 | 6.19E-06 | NA | mr1778 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216037905 | 1.14E-06 | NA | mr1022_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216037905 | 1.62E-06 | NA | mr1022_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216037905 | 2.81E-08 | NA | mr1023_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216037905 | 4.96E-06 | NA | mr1023_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216037905 | NA | 3.73E-09 | mr1057_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216037905 | 1.25E-09 | NA | mr1079_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216037905 | 1.72E-08 | NA | mr1079_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216037905 | 2.93E-10 | NA | mr1489_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216037905 | 7.19E-06 | NA | mr1489_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216037905 | 1.44E-08 | NA | mr1778_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |