\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1216037905:

Variant ID: vg1216037905 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 16037905
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.92, A: 0.08, others allele: 0.00, population size: 78. )

Flanking Sequence (100 bp) in Reference Genome:


TATACCCGAGAATTACAAGATACGTCCATAACGGACACGACTACTATCTCTAACAAACTCCAAGATACCATAAGTCTTTGCGGCAAACTTTTGCCCAAGC[A/G]
TATCTCTAATGAAATTACATAAAACATCCTAATTAATAGATACAATTGCCTTCTCAGGACTCTATCCATGTACGGCAATCACCTTGAAGCACCTCAATTC

Reverse complement sequence

GAATTGAGGTGCTTCAAGGTGATTGCCGTACATGGATAGAGTCCTGAGAAGGCAATTGTATCTATTAATTAGGATGTTTTATGTAATTTCATTAGAGATA[T/C]
GCTTGGGCAAAAGTTTGCCGCAAAGACTTATGGTATCTTGGAGTTTGTTAGAGATAGTAGTCGTGTCCGTTATGGACGTATCTTGTAATTCTCGGGTATA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 26.10% 3.90% 21.75% 48.24% NA
All Indica  2759 7.30% 1.50% 31.82% 59.41% NA
All Japonica  1512 60.60% 3.70% 5.03% 30.69% NA
Aus  269 19.00% 10.80% 22.68% 47.58% NA
Indica I  595 8.90% 0.70% 18.49% 71.93% NA
Indica II  465 10.30% 1.30% 26.24% 62.15% NA
Indica III  913 1.90% 1.60% 45.02% 51.48% NA
Indica Intermediate  786 10.60% 2.00% 29.90% 57.51% NA
Temperate Japonica  767 91.30% 3.70% 0.78% 4.30% NA
Tropical Japonica  504 12.10% 0.80% 13.49% 73.61% NA
Japonica Intermediate  241 64.30% 10.00% 0.83% 24.90% NA
VI/Aromatic  96 28.10% 54.20% 6.25% 11.46% NA
Intermediate  90 42.20% 7.80% 7.78% 42.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1216037905 A -> DEL N N silent_mutation Average:8.56; most accessible tissue: Zhenshan97 root, score: 12.891 N N N N
vg1216037905 A -> G LOC_Os12g27300.1 upstream_gene_variant ; 1293.0bp to feature; MODIFIER silent_mutation Average:8.56; most accessible tissue: Zhenshan97 root, score: 12.891 N N N N
vg1216037905 A -> G LOC_Os12g27290.1 downstream_gene_variant ; 3855.0bp to feature; MODIFIER silent_mutation Average:8.56; most accessible tissue: Zhenshan97 root, score: 12.891 N N N N
vg1216037905 A -> G LOC_Os12g27310.1 downstream_gene_variant ; 4156.0bp to feature; MODIFIER silent_mutation Average:8.56; most accessible tissue: Zhenshan97 root, score: 12.891 N N N N
vg1216037905 A -> G LOC_Os12g27290-LOC_Os12g27300 intergenic_region ; MODIFIER silent_mutation Average:8.56; most accessible tissue: Zhenshan97 root, score: 12.891 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1216037905 NA 1.28E-07 mr1057 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216037905 6.19E-06 NA mr1778 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216037905 1.14E-06 NA mr1022_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216037905 1.62E-06 NA mr1022_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216037905 2.81E-08 NA mr1023_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216037905 4.96E-06 NA mr1023_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216037905 NA 3.73E-09 mr1057_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216037905 1.25E-09 NA mr1079_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216037905 1.72E-08 NA mr1079_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216037905 2.93E-10 NA mr1489_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216037905 7.19E-06 NA mr1489_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216037905 1.44E-08 NA mr1778_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251