\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1216037604:

Variant ID: vg1216037604 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 16037604
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACCCTCTACCGACAGATGTTAGCCGATTGTAGATTAGATAGCGGTATTGCCGGAGATTATGTAAGATATATGATAACTCGACGAATTACATAAACGAGAT[C/T]
AGAGTATCATAAAGATGGAAGCACTAATCCCGAGAACACAAGTCGTCGTAACAAGTTTTACCTTTTGTTGAAGATCGAAACCGATGCAGCTCAACCCGAA

Reverse complement sequence

TTCGGGTTGAGCTGCATCGGTTTCGATCTTCAACAAAAGGTAAAACTTGTTACGACGACTTGTGTTCTCGGGATTAGTGCTTCCATCTTTATGATACTCT[G/A]
ATCTCGTTTATGTAATTCGTCGAGTTATCATATATCTTACATAATCTCCGGCAATACCGCTATCTAATCTACAATCGGCTAACATCTGTCGGTAGAGGGT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.40% 0.20% 3.34% 34.05% NA
All Indica  2759 58.70% 0.20% 3.91% 37.15% NA
All Japonica  1512 67.30% 0.30% 2.71% 29.63% NA
Aus  269 61.00% 0.00% 2.97% 36.06% NA
Indica I  595 46.60% 0.20% 5.88% 47.39% NA
Indica II  465 68.40% 0.40% 2.80% 28.39% NA
Indica III  913 60.00% 0.20% 2.08% 37.68% NA
Indica Intermediate  786 60.70% 0.10% 5.22% 33.97% NA
Temperate Japonica  767 96.00% 0.00% 0.13% 3.91% NA
Tropical Japonica  504 20.00% 1.00% 7.54% 71.43% NA
Japonica Intermediate  241 75.10% 0.00% 0.83% 24.07% NA
VI/Aromatic  96 90.60% 0.00% 0.00% 9.38% NA
Intermediate  90 65.60% 0.00% 1.11% 33.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1216037604 C -> DEL N N silent_mutation Average:8.548; most accessible tissue: Minghui63 root, score: 15.664 N N N N
vg1216037604 C -> T LOC_Os12g27300.1 upstream_gene_variant ; 1594.0bp to feature; MODIFIER silent_mutation Average:8.548; most accessible tissue: Minghui63 root, score: 15.664 N N N N
vg1216037604 C -> T LOC_Os12g27290.1 downstream_gene_variant ; 3554.0bp to feature; MODIFIER silent_mutation Average:8.548; most accessible tissue: Minghui63 root, score: 15.664 N N N N
vg1216037604 C -> T LOC_Os12g27310.1 downstream_gene_variant ; 4457.0bp to feature; MODIFIER silent_mutation Average:8.548; most accessible tissue: Minghui63 root, score: 15.664 N N N N
vg1216037604 C -> T LOC_Os12g27290-LOC_Os12g27300 intergenic_region ; MODIFIER silent_mutation Average:8.548; most accessible tissue: Minghui63 root, score: 15.664 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1216037604 NA 1.20E-12 mr1016 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216037604 NA 2.73E-13 mr1017 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216037604 NA 1.17E-10 mr1018 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216037604 NA 2.08E-09 mr1019 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216037604 NA 2.91E-13 mr1055 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216037604 NA 1.52E-12 mr1132 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216037604 NA 1.23E-12 mr1178 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216037604 NA 4.22E-07 mr1308 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216037604 NA 2.70E-11 mr1390 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216037604 NA 6.05E-07 mr1401 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216037604 NA 4.31E-07 mr1443 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216037604 NA 1.32E-11 mr1490 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216037604 NA 1.48E-06 mr1511 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216037604 NA 2.49E-09 mr1551 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216037604 NA 1.34E-06 mr1564 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216037604 NA 3.60E-07 mr1696 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216037604 2.01E-06 8.59E-06 mr1874 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216037604 NA 1.75E-10 mr1019_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216037604 NA 3.03E-13 mr1055_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216037604 NA 8.88E-16 mr1132_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216037604 NA 1.44E-19 mr1178_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216037604 NA 7.65E-08 mr1261_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216037604 NA 5.54E-07 mr1347_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216037604 NA 3.57E-15 mr1390_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216037604 8.12E-06 6.84E-16 mr1490_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216037604 NA 1.07E-06 mr1632_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216037604 NA 1.47E-08 mr1696_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216037604 NA 1.16E-06 mr1705_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251