| Variant ID: vg1216034987 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 16034987 |
| Reference Allele: T | Alternative Allele: G |
| Primary Allele: T | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
AAAGATTTAATTGTAACGAATATAATGGTGTAAACAGATCGTAGATTGGATGAGTAATCTGGAAGAAAAATCATTTTCAAGTTTGCTAAAAGGTGTTATG[T/G]
ACATGCAAATAATCTCGTGTTCTCTCTCCTTCATACATGCCAATGCTAAGTAAGGGAGCATATGTAACAGGTGTGAAAAGATAGTATCTGACAAAAAAGG
CCTTTTTTGTCAGATACTATCTTTTCACACCTGTTACATATGCTCCCTTACTTAGCATTGGCATGTATGAAGGAGAGAGAACACGAGATTATTTGCATGT[A/C]
CATAACACCTTTTAGCAAACTTGAAAATGATTTTTCTTCCAGATTACTCATCCAATCTACGATCTGTTTACACCATTATATTCGTTACAATTAAATCTTT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 57.00% | 19.90% | 12.10% | 10.98% | NA |
| All Indica | 2759 | 51.70% | 33.30% | 14.57% | 0.40% | NA |
| All Japonica | 1512 | 65.50% | 0.30% | 3.04% | 31.22% | NA |
| Aus | 269 | 51.30% | 1.10% | 37.55% | 10.04% | NA |
| Indica I | 595 | 44.70% | 27.70% | 27.56% | 0.00% | NA |
| Indica II | 465 | 62.80% | 21.70% | 15.27% | 0.22% | NA |
| Indica III | 913 | 53.70% | 42.40% | 3.83% | 0.11% | NA |
| Indica Intermediate | 786 | 48.10% | 34.00% | 16.79% | 1.15% | NA |
| Temperate Japonica | 767 | 96.10% | 0.00% | 1.30% | 2.61% | NA |
| Tropical Japonica | 504 | 13.70% | 0.80% | 5.16% | 80.36% | NA |
| Japonica Intermediate | 241 | 76.30% | 0.00% | 4.15% | 19.50% | NA |
| VI/Aromatic | 96 | 84.40% | 1.00% | 9.38% | 5.21% | NA |
| Intermediate | 90 | 67.80% | 12.20% | 15.56% | 4.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1216034987 | T -> DEL | N | N | silent_mutation | Average:49.28; most accessible tissue: Callus, score: 87.78 | N | N | N | N |
| vg1216034987 | T -> G | LOC_Os12g27300.1 | upstream_gene_variant ; 4211.0bp to feature; MODIFIER | silent_mutation | Average:49.28; most accessible tissue: Callus, score: 87.78 | N | N | N | N |
| vg1216034987 | T -> G | LOC_Os12g27290.1 | downstream_gene_variant ; 937.0bp to feature; MODIFIER | silent_mutation | Average:49.28; most accessible tissue: Callus, score: 87.78 | N | N | N | N |
| vg1216034987 | T -> G | LOC_Os12g27290-LOC_Os12g27300 | intergenic_region ; MODIFIER | silent_mutation | Average:49.28; most accessible tissue: Callus, score: 87.78 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1216034987 | NA | 5.66E-13 | mr1739 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216034987 | 4.81E-07 | 3.76E-12 | mr1739 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216034987 | NA | 5.18E-12 | mr1739_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216034987 | NA | 2.07E-10 | mr1739_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |