Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1216023976:

Variant ID: vg1216023976 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 16023976
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 93. )

Flanking Sequence (100 bp) in Reference Genome:

CCTCCATATTTTAATGTATGACGCCGTTGACTTTTTAATCAATGTTTGACCACTCGTCTTATTCAAAATTTTTATACAAATATAAAAATACTTATGTCAT[G/A]
CTTAAAGAACATTTGATGATAAATCAAGTCACAATAAAATAAATTATAATTACATAAATTTTTTGAATAAGACGAAAGATCAATGTTTATTAAAAAGTTA

Reverse complement sequence

TAACTTTTTAATAAACATTGATCTTTCGTCTTATTCAAAAAATTTATGTAATTATAATTTATTTTATTGTGACTTGATTTATCATCAAATGTTCTTTAAG[C/T]
ATGACATAAGTATTTTTATATTTGTATAAAAATTTTGAATAAGACGAGTGGTCAAACATTGATTAAAAAGTCAACGGCGTCATACATTAAAATATGGAGG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	21.30%	5.00%	3.07%	70.65%	NA
All Indica	2759	5.30%	0.40%	2.36%	91.92%	NA
All Japonica	1512	49.30%	11.10%	4.10%	35.45%	NA
Aus	269	12.60%	7.10%	4.46%	75.84%	NA
Indica I	595	5.20%	0.30%	3.36%	91.09%	NA
Indica II	465	7.30%	0.20%	2.80%	89.68%	NA
Indica III	913	2.10%	0.20%	1.42%	96.28%	NA
Indica Intermediate	786	7.90%	0.90%	2.42%	88.80%	NA
Temperate Japonica	767	84.20%	5.00%	6.26%	4.56%	NA
Tropical Japonica	504	1.20%	9.90%	1.19%	87.70%	NA
Japonica Intermediate	241	39.00%	33.20%	3.32%	24.48%	NA
VI/Aromatic	96	54.20%	28.10%	1.04%	16.67%	NA
Intermediate	90	30.00%	12.20%	5.56%	52.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1216023976	G -> DEL	N	N	silent_mutation	Average:23.001; most accessible tissue: Callus, score: 68.366	N	N	N	N
vg1216023976	G -> A	LOC_Os12g27270-LOC_Os12g27280	intergenic_region ; MODIFIER	silent_mutation	Average:23.001; most accessible tissue: Callus, score: 68.366	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1216023976	3.90E-06	NA	mr1018	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216023976	7.51E-07	NA	mr1023	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216023976	7.75E-07	NA	mr1142	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216023976	2.04E-07	NA	mr1489	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216023976	2.29E-07	NA	mr1491	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216023976	2.35E-07	NA	mr1778	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216023976	6.01E-08	NA	mr1023_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216023976	2.46E-07	NA	mr1079_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216023976	NA	4.39E-08	mr1084_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216023976	1.46E-06	NA	mr1137_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216023976	NA	2.31E-07	mr1149_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216023976	NA	2.15E-07	mr1205_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216023976	NA	3.96E-06	mr1318_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216023976	NA	7.69E-07	mr1441_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216023976	2.42E-10	NA	mr1489_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216023976	NA	5.83E-07	mr1604_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216023976	1.30E-06	NA	mr1617_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216023976	NA	3.37E-07	mr1617_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216023976	NA	7.89E-06	mr1728_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216023976	6.57E-06	6.56E-06	mr1777_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216023976	9.67E-09	NA	mr1778_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216023976	NA	6.73E-06	mr1788_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251