\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1216023976:

Variant ID: vg1216023976 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 16023976
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 93. )

Flanking Sequence (100 bp) in Reference Genome:


CCTCCATATTTTAATGTATGACGCCGTTGACTTTTTAATCAATGTTTGACCACTCGTCTTATTCAAAATTTTTATACAAATATAAAAATACTTATGTCAT[G/A]
CTTAAAGAACATTTGATGATAAATCAAGTCACAATAAAATAAATTATAATTACATAAATTTTTTGAATAAGACGAAAGATCAATGTTTATTAAAAAGTTA

Reverse complement sequence

TAACTTTTTAATAAACATTGATCTTTCGTCTTATTCAAAAAATTTATGTAATTATAATTTATTTTATTGTGACTTGATTTATCATCAAATGTTCTTTAAG[C/T]
ATGACATAAGTATTTTTATATTTGTATAAAAATTTTGAATAAGACGAGTGGTCAAACATTGATTAAAAAGTCAACGGCGTCATACATTAAAATATGGAGG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 21.30% 5.00% 3.07% 70.65% NA
All Indica  2759 5.30% 0.40% 2.36% 91.92% NA
All Japonica  1512 49.30% 11.10% 4.10% 35.45% NA
Aus  269 12.60% 7.10% 4.46% 75.84% NA
Indica I  595 5.20% 0.30% 3.36% 91.09% NA
Indica II  465 7.30% 0.20% 2.80% 89.68% NA
Indica III  913 2.10% 0.20% 1.42% 96.28% NA
Indica Intermediate  786 7.90% 0.90% 2.42% 88.80% NA
Temperate Japonica  767 84.20% 5.00% 6.26% 4.56% NA
Tropical Japonica  504 1.20% 9.90% 1.19% 87.70% NA
Japonica Intermediate  241 39.00% 33.20% 3.32% 24.48% NA
VI/Aromatic  96 54.20% 28.10% 1.04% 16.67% NA
Intermediate  90 30.00% 12.20% 5.56% 52.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1216023976 G -> DEL N N silent_mutation Average:23.001; most accessible tissue: Callus, score: 68.366 N N N N
vg1216023976 G -> A LOC_Os12g27270-LOC_Os12g27280 intergenic_region ; MODIFIER silent_mutation Average:23.001; most accessible tissue: Callus, score: 68.366 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1216023976 3.90E-06 NA mr1018 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216023976 7.51E-07 NA mr1023 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216023976 7.75E-07 NA mr1142 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216023976 2.04E-07 NA mr1489 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216023976 2.29E-07 NA mr1491 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216023976 2.35E-07 NA mr1778 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216023976 6.01E-08 NA mr1023_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216023976 2.46E-07 NA mr1079_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216023976 NA 4.39E-08 mr1084_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216023976 1.46E-06 NA mr1137_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216023976 NA 2.31E-07 mr1149_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216023976 NA 2.15E-07 mr1205_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216023976 NA 3.96E-06 mr1318_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216023976 NA 7.69E-07 mr1441_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216023976 2.42E-10 NA mr1489_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216023976 NA 5.83E-07 mr1604_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216023976 1.30E-06 NA mr1617_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216023976 NA 3.37E-07 mr1617_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216023976 NA 7.89E-06 mr1728_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216023976 6.57E-06 6.56E-06 mr1777_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216023976 9.67E-09 NA mr1778_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216023976 NA 6.73E-06 mr1788_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251