\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1216017848:

Variant ID: vg1216017848 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 16017848
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACAATTAGTTTAACGTTTTGAAACATATGTTTTTTTATCATAATATAATAATGCGATATTTTTTTTAAAGATTTTATTGTAACGAATACAATGATATGAT[C/T]
AGATAGTAGATTGGATAAATTGTTTAGGAGAAAAATTATTTGAAAGCTTTCTAAATACATTCATGCATGGAGGAGAGAGAGAGGCATGAGAGAGAACAAG

Reverse complement sequence

CTTGTTCTCTCTCATGCCTCTCTCTCTCCTCCATGCATGAATGTATTTAGAAAGCTTTCAAATAATTTTTCTCCTAAACAATTTATCCAATCTACTATCT[G/A]
ATCATATCATTGTATTCGTTACAATAAAATCTTTAAAAAAAATATCGCATTATTATATTATGATAAAAAAACATATGTTTCAAAACGTTAAACTAATTGT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 73.70% 5.30% 0.34% 20.61% NA
All Indica  2759 67.20% 0.50% 0.58% 31.71% NA
All Japonica  1512 84.40% 15.30% 0.00% 0.33% NA
Aus  269 69.10% 0.40% 0.00% 30.48% NA
Indica I  595 82.90% 0.00% 0.50% 16.64% NA
Indica II  465 81.90% 0.40% 0.65% 16.99% NA
Indica III  913 46.20% 0.90% 0.22% 52.68% NA
Indica Intermediate  786 71.10% 0.40% 1.02% 27.48% NA
Temperate Japonica  767 99.00% 1.00% 0.00% 0.00% NA
Tropical Japonica  504 60.10% 39.50% 0.00% 0.40% NA
Japonica Intermediate  241 88.80% 10.00% 0.00% 1.24% NA
VI/Aromatic  96 91.70% 4.20% 0.00% 4.17% NA
Intermediate  90 87.80% 3.30% 0.00% 8.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1216017848 C -> DEL N N silent_mutation Average:30.001; most accessible tissue: Callus, score: 48.683 N N N N
vg1216017848 C -> T LOC_Os12g27270.1 upstream_gene_variant ; 1320.0bp to feature; MODIFIER silent_mutation Average:30.001; most accessible tissue: Callus, score: 48.683 N N N N
vg1216017848 C -> T LOC_Os12g27270-LOC_Os12g27280 intergenic_region ; MODIFIER silent_mutation Average:30.001; most accessible tissue: Callus, score: 48.683 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1216017848 5.62E-09 4.00E-14 mr1016 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216017848 1.93E-09 8.48E-14 mr1017 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216017848 1.85E-07 5.54E-11 mr1018 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216017848 4.48E-07 1.32E-11 mr1019 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216017848 8.51E-06 NA mr1023 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216017848 8.11E-09 3.65E-14 mr1055 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216017848 6.92E-09 3.93E-13 mr1132 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216017848 NA 5.42E-10 mr1178 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216017848 5.56E-07 4.12E-11 mr1390 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216017848 4.20E-06 NA mr1489 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216017848 3.58E-06 NA mr1490 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216017848 6.10E-06 NA mr1778 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216017848 3.98E-06 NA mr1019_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216017848 1.88E-08 NA mr1023_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216017848 3.51E-10 2.73E-13 mr1055_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216017848 3.29E-11 3.38E-14 mr1132_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216017848 1.17E-08 NA mr1178_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216017848 4.01E-06 1.55E-08 mr1261_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216017848 5.00E-10 1.71E-13 mr1390_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216017848 9.12E-07 NA mr1489_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216017848 1.99E-10 5.69E-14 mr1490_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216017848 3.22E-06 NA mr1778_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251