\
| Variant ID: vg1215978234 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 15978234 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 113. )
ATAATTAGTTGTATTGGTATAAATTTGATAGTACCGGCCAGCCAATCCTGACGGATAACTTCTTCTGGGATGGAATATGTTCTGGTCCACCTCTTTTGCG[G/A]
TAGTACTTGTGTGCTCTGTTTGAAGGAAACAATTGTTTTATTAGTAGTTAGAAGACTGGTGATCGACCTAAACAATTTATAGTAATGAAATGTTTATCAC
GTGATAAACATTTCATTACTATAAATTGTTTAGGTCGATCACCAGTCTTCTAACTACTAATAAAACAATTGTTTCCTTCAAACAGAGCACACAAGTACTA[C/T]
CGCAAAAGAGGTGGACCAGAACATATTCCATCCCAGAAGAAGTTATCCGTCAGGATTGGCTGGCCGGTACTATCAAATTTATACCAATACAACTAATTAT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 17.50% | 5.20% | 16.72% | 60.56% | NA |
| All Indica | 2759 | 3.20% | 0.40% | 15.40% | 81.08% | NA |
| All Japonica | 1512 | 47.00% | 12.00% | 18.72% | 22.35% | NA |
| Aus | 269 | 2.20% | 6.70% | 21.56% | 69.52% | NA |
| Indica I | 595 | 0.80% | 0.30% | 2.52% | 96.30% | NA |
| Indica II | 465 | 3.90% | 0.20% | 38.49% | 57.42% | NA |
| Indica III | 913 | 2.40% | 0.20% | 12.81% | 84.56% | NA |
| Indica Intermediate | 786 | 5.30% | 0.60% | 14.50% | 79.52% | NA |
| Temperate Japonica | 767 | 81.20% | 6.90% | 7.69% | 4.17% | NA |
| Tropical Japonica | 504 | 1.80% | 9.70% | 37.70% | 50.79% | NA |
| Japonica Intermediate | 241 | 32.40% | 32.80% | 14.11% | 20.75% | NA |
| VI/Aromatic | 96 | 2.10% | 28.10% | 4.17% | 65.62% | NA |
| Intermediate | 90 | 23.30% | 13.30% | 22.22% | 41.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1215978234 | G -> DEL | LOC_Os12g27230.1 | N | frameshift_variant | Average:10.145; most accessible tissue: Callus, score: 29.238 | N | N | N | N |
| vg1215978234 | G -> A | LOC_Os12g27230.1 | synonymous_variant ; p.Tyr635Tyr; LOW | synonymous_codon | Average:10.145; most accessible tissue: Callus, score: 29.238 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1215978234 | 7.71E-07 | NA | mr1017 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215978234 | 7.26E-06 | NA | mr1019 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215978234 | 4.49E-09 | NA | mr1022 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215978234 | 2.47E-09 | NA | mr1023 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215978234 | 4.69E-07 | NA | mr1055 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215978234 | 3.93E-10 | NA | mr1079 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215978234 | 5.00E-06 | NA | mr1132 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215978234 | 1.86E-11 | NA | mr1142 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215978234 | NA | 8.10E-07 | mr1280 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215978234 | 4.80E-11 | NA | mr1489 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215978234 | 6.57E-10 | NA | mr1491 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215978234 | 1.55E-08 | NA | mr1778 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215978234 | NA | 9.36E-06 | mr1788 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215978234 | 2.50E-06 | NA | mr1023_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215978234 | NA | 3.42E-06 | mr1051_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215978234 | 1.72E-06 | NA | mr1079_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215978234 | NA | 1.15E-06 | mr1318_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215978234 | 1.82E-07 | NA | mr1489_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215978234 | NA | 7.88E-06 | mr1728_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215978234 | 5.25E-06 | 5.25E-06 | mr1777_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215978234 | NA | 1.86E-06 | mr1788_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |