\
| Variant ID: vg1215976560 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 15976560 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
GGGCATCAGCATGGATGCGGGAGGGCGGTGTCGCAGTGCTACAACGGTATTCGTGCGCTTATGGATTTATCTATGATTATAACAACTACCAACATGCGGC[G/A]
GAGGCAAGGTCACCCATCAGTAGCGTGGCGGAGTTTACCGCCATGTAGGAGAAGCCACCAGTCGGCGACGGCATAGTCGACTGGCAGTGGAGACGAGGTC
GACCTCGTCTCCACTGCCAGTCGACTATGCCGTCGCCGACTGGTGGCTTCTCCTACATGGCGGTAAACTCCGCCACGCTACTGATGGGTGACCTTGCCTC[C/T]
GCCGCATGTTGGTAGTTGTTATAATCATAGATAAATCCATAAGCGCACGAATACCGTTGTAGCACTGCGACACCGCCCTCCCGCATCCATGCTGATGCCC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 91.40% | 5.90% | 1.08% | 1.57% | NA |
| All Indica | 2759 | 96.60% | 0.40% | 0.43% | 2.61% | NA |
| All Japonica | 1512 | 83.30% | 14.10% | 2.51% | 0.07% | NA |
| Aus | 269 | 92.90% | 7.10% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.30% | 0.30% | 0.34% | 0.00% | NA |
| Indica II | 465 | 85.20% | 0.20% | 1.72% | 12.90% | NA |
| Indica III | 913 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 97.50% | 0.80% | 0.25% | 1.53% | NA |
| Temperate Japonica | 767 | 87.10% | 9.30% | 3.65% | 0.00% | NA |
| Tropical Japonica | 504 | 90.30% | 9.70% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 56.80% | 38.60% | 4.15% | 0.41% | NA |
| VI/Aromatic | 96 | 71.90% | 28.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 84.40% | 13.30% | 1.11% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1215976560 | G -> DEL | N | N | silent_mutation | Average:56.468; most accessible tissue: Zhenshan97 young leaf, score: 86.852 | N | N | N | N |
| vg1215976560 | G -> A | LOC_Os12g27220.1 | upstream_gene_variant ; 3059.0bp to feature; MODIFIER | silent_mutation | Average:56.468; most accessible tissue: Zhenshan97 young leaf, score: 86.852 | N | N | N | N |
| vg1215976560 | G -> A | LOC_Os12g27230.1 | downstream_gene_variant ; 1142.0bp to feature; MODIFIER | silent_mutation | Average:56.468; most accessible tissue: Zhenshan97 young leaf, score: 86.852 | N | N | N | N |
| vg1215976560 | G -> A | LOC_Os12g27220-LOC_Os12g27230 | intergenic_region ; MODIFIER | silent_mutation | Average:56.468; most accessible tissue: Zhenshan97 young leaf, score: 86.852 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1215976560 | 3.93E-06 | NA | mr1017 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215976560 | 2.10E-08 | NA | mr1022 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215976560 | 3.03E-10 | NA | mr1023 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215976560 | 1.88E-06 | NA | mr1055 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215976560 | 5.65E-11 | NA | mr1079 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215976560 | 1.03E-10 | NA | mr1142 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215976560 | NA | 5.22E-06 | mr1280 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215976560 | NA | 4.44E-06 | mr1280 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215976560 | 2.20E-11 | NA | mr1489 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215976560 | 7.00E-11 | NA | mr1491 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215976560 | 2.50E-08 | NA | mr1778 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215976560 | 3.31E-07 | NA | mr1022_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215976560 | 1.89E-08 | NA | mr1023_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215976560 | 1.06E-08 | NA | mr1079_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215976560 | 1.42E-09 | NA | mr1489_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215976560 | 5.69E-07 | NA | mr1778_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |