| Variant ID: vg1215970005 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 15970005 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
GATCAGCAACAAGGTGATCATGGAAGGCTTCTTTTAAAACAAGTGATCATGGAAGGATCAAGGGTGAAAGAATGCAACAGCAACTTAAGAGTTGAGATAA[T/C]
CTATCAATTTAGCAGGCAAATCAGGTTTTCAGCGCTTTTCTTCTTTTTTAAAAAAATAAATAGGTATTTTCCCACTGCGATCATAAATAATAAATTCAAA
TTTGAATTTATTATTTATGATCGCAGTGGGAAAATACCTATTTATTTTTTTAAAAAAGAAGAAAAGCGCTGAAAACCTGATTTGCCTGCTAAATTGATAG[A/G]
TTATCTCAACTCTTAAGTTGCTGTTGCATTCTTTCACCCTTGATCCTTCCATGATCACTTGTTTTAAAAGAAGCCTTCCATGATCACCTTGTTGCTGATC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 97.20% | 1.00% | 0.21% | 1.59% | NA |
| All Indica | 2759 | 97.00% | 0.00% | 0.25% | 2.68% | NA |
| All Japonica | 1512 | 96.80% | 3.00% | 0.20% | 0.07% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 85.20% | 0.00% | 1.29% | 13.55% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 98.30% | 0.10% | 0.13% | 1.40% | NA |
| Temperate Japonica | 767 | 97.40% | 2.50% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 88.40% | 10.40% | 0.83% | 0.41% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1215970005 | T -> C | LOC_Os12g27210.1 | downstream_gene_variant ; 1414.0bp to feature; MODIFIER | silent_mutation | Average:32.329; most accessible tissue: Callus, score: 61.175 | N | N | N | N |
| vg1215970005 | T -> C | LOC_Os12g27220.1 | intron_variant ; MODIFIER | silent_mutation | Average:32.329; most accessible tissue: Callus, score: 61.175 | N | N | N | N |
| vg1215970005 | T -> DEL | N | N | silent_mutation | Average:32.329; most accessible tissue: Callus, score: 61.175 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1215970005 | 2.63E-06 | 2.63E-06 | mr1750 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215970005 | 8.91E-07 | NA | mr1022_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215970005 | 1.78E-08 | NA | mr1023_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215970005 | 1.81E-09 | NA | mr1079_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215970005 | 3.83E-08 | NA | mr1489_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215970005 | 4.62E-06 | NA | mr1778_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |