\
| Variant ID: vg1215966676 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 15966676 |
| Reference Allele: C | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.75, G: 0.26, others allele: 0.00, population size: 173. )
ATATATTGTATATGAATTGAATATATTGATATTGTTGGAGAGACGAGGGATTGCAGTTTTCAGGTTGCTCACATCATTCTGTTGATTGCTTTTATGTCTA[C/G]
AAAAGTTTAAGGATTACTGCACCAGCTGTCTATGCGATACGACTAATATCTTTTGCACTGTAATAGTTAACTGATTTTCTTGGTCATCTGTATATGTTTA
TAAACATATACAGATGACCAAGAAAATCAGTTAACTATTACAGTGCAAAAGATATTAGTCGTATCGCATAGACAGCTGGTGCAGTAATCCTTAAACTTTT[G/C]
TAGACATAAAAGCAATCAACAGAATGATGTGAGCAACCTGAAAACTGCAATCCCTCGTCTCTCCAACAATATCAATATATTCAATTCATATACAATATAT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 69.20% | 30.60% | 0.15% | 0.00% | NA |
| All Indica | 2759 | 92.70% | 7.10% | 0.18% | 0.00% | NA |
| All Japonica | 1512 | 23.70% | 76.30% | 0.00% | 0.00% | NA |
| Aus | 269 | 91.80% | 8.20% | 0.00% | 0.00% | NA |
| Indica I | 595 | 96.30% | 3.40% | 0.34% | 0.00% | NA |
| Indica II | 465 | 84.90% | 14.80% | 0.22% | 0.00% | NA |
| Indica III | 913 | 96.20% | 3.70% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 90.50% | 9.40% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 4.70% | 95.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 53.60% | 46.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 21.60% | 78.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 70.80% | 28.10% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 46.70% | 52.20% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1215966676 | C -> G | LOC_Os12g27210.1 | 3_prime_UTR_variant ; 176.0bp to feature; MODIFIER | silent_mutation | Average:47.71; most accessible tissue: Callus, score: 79.148 | N | N | N | N |
| vg1215966676 | C -> G | LOC_Os12g27190.1 | downstream_gene_variant ; 4764.0bp to feature; MODIFIER | silent_mutation | Average:47.71; most accessible tissue: Callus, score: 79.148 | N | N | N | N |
| vg1215966676 | C -> G | LOC_Os12g27200.1 | downstream_gene_variant ; 3186.0bp to feature; MODIFIER | silent_mutation | Average:47.71; most accessible tissue: Callus, score: 79.148 | N | N | N | N |
| vg1215966676 | C -> G | LOC_Os12g27220.1 | downstream_gene_variant ; 3138.0bp to feature; MODIFIER | silent_mutation | Average:47.71; most accessible tissue: Callus, score: 79.148 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1215966676 | 9.34E-64 | 1.79E-153 | mr1016 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215966676 | 5.32E-36 | 1.40E-80 | mr1016 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215966676 | 3.19E-22 | 9.71E-42 | mr1016 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215966676 | 8.55E-62 | 1.26E-127 | mr1017 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215966676 | 1.33E-32 | 2.70E-68 | mr1017 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215966676 | 1.51E-21 | 3.59E-41 | mr1017 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215966676 | 7.71E-42 | 7.73E-129 | mr1018 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215966676 | 7.48E-10 | 1.37E-12 | mr1018 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215966676 | 1.44E-21 | 1.02E-38 | mr1018 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215966676 | 4.40E-28 | 1.36E-90 | mr1019 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215966676 | 1.93E-18 | 1.25E-30 | mr1019 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215966676 | 1.46E-35 | 3.02E-89 | mr1022 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215966676 | 3.33E-34 | 3.26E-74 | mr1022 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215966676 | 1.60E-07 | 7.98E-16 | mr1022 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215966676 | 2.59E-46 | 5.61E-144 | mr1023 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215966676 | 9.01E-21 | 2.77E-46 | mr1023 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215966676 | 6.70E-14 | 5.70E-28 | mr1023 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215966676 | NA | 7.25E-06 | mr1044 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215966676 | 1.64E-73 | 3.98E-136 | mr1055 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215966676 | 9.88E-34 | 3.64E-75 | mr1055 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215966676 | 9.83E-26 | 1.18E-47 | mr1055 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215966676 | NA | 3.40E-13 | mr1056 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215966676 | 3.06E-51 | 9.48E-142 | mr1079 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215966676 | 1.98E-33 | 6.42E-78 | mr1079 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215966676 | 8.69E-14 | 3.24E-30 | mr1079 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215966676 | NA | 2.72E-06 | mr1089 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215966676 | NA | 4.71E-08 | mr1093 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215966676 | NA | 8.39E-07 | mr1109 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215966676 | 8.93E-62 | 4.13E-181 | mr1132 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215966676 | 3.52E-24 | 4.44E-51 | mr1132 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215966676 | 2.40E-23 | 4.78E-44 | mr1132 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215966676 | 1.66E-48 | 9.30E-153 | mr1142 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215966676 | 1.26E-22 | 7.06E-51 | mr1142 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215966676 | 1.59E-14 | 4.22E-29 | mr1142 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215966676 | NA | 8.93E-15 | mr1156 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215966676 | 8.95E-42 | 2.31E-140 | mr1178 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215966676 | 2.07E-30 | 2.04E-64 | mr1178 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215966676 | 2.40E-11 | 8.78E-26 | mr1178 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215966676 | NA | 1.86E-06 | mr1235 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215966676 | NA | 8.74E-11 | mr1277 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215966676 | NA | 8.18E-14 | mr1301 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215966676 | NA | 1.01E-07 | mr1352 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215966676 | 2.91E-57 | 5.85E-166 | mr1390 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215966676 | 1.86E-32 | 9.57E-73 | mr1390 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215966676 | 6.10E-22 | 3.86E-44 | mr1390 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215966676 | 4.10E-42 | 5.81E-137 | mr1489 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215966676 | 9.24E-13 | 6.14E-24 | mr1489 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215966676 | 1.70E-14 | 3.82E-29 | mr1489 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215966676 | 1.12E-56 | 3.70E-162 | mr1490 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215966676 | 7.35E-30 | 3.35E-65 | mr1490 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215966676 | 3.50E-23 | 1.03E-46 | mr1490 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215966676 | 7.00E-50 | 2.08E-156 | mr1491 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215966676 | 5.43E-23 | 4.21E-51 | mr1491 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215966676 | 9.61E-16 | 6.18E-30 | mr1491 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215966676 | 5.38E-08 | 1.84E-43 | mr1546 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215966676 | 7.33E-13 | 1.02E-28 | mr1546 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215966676 | 2.86E-06 | 1.52E-09 | mr1577 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215966676 | 1.48E-06 | 5.23E-07 | mr1577 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215966676 | NA | 2.05E-06 | mr1580 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215966676 | 1.65E-07 | 2.57E-11 | mr1587 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215966676 | 3.78E-08 | 1.24E-09 | mr1587 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215966676 | NA | 5.11E-07 | mr1599 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215966676 | NA | 3.75E-06 | mr1743 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215966676 | 3.51E-23 | 7.11E-96 | mr1778 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215966676 | 2.72E-14 | 6.77E-27 | mr1778 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215966676 | 7.81E-08 | 1.92E-41 | mr1780 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215966676 | 2.93E-07 | 6.18E-09 | mr1780 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215966676 | NA | 5.81E-07 | mr1780 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215966676 | NA | 1.06E-09 | mr1790 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215966676 | 2.87E-06 | 2.52E-07 | mr1792 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215966676 | NA | 1.63E-08 | mr1803 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215966676 | 1.22E-07 | 1.30E-08 | mr1803 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215966676 | NA | 1.29E-29 | mr1805 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215966676 | NA | 2.04E-10 | mr1805 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215966676 | NA | 2.17E-07 | mr1951 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215966676 | 2.95E-38 | 7.58E-116 | mr1019_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215966676 | 4.12E-09 | 1.88E-10 | mr1019_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215966676 | 5.43E-18 | 6.43E-31 | mr1019_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215966676 | 2.78E-40 | 4.94E-117 | mr1022_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215966676 | 1.18E-39 | 1.01E-90 | mr1022_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215966676 | 5.52E-09 | 1.69E-20 | mr1022_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215966676 | 7.46E-49 | 5.96E-170 | mr1023_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215966676 | 7.78E-22 | 3.66E-46 | mr1023_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215966676 | 1.34E-18 | 9.75E-37 | mr1023_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215966676 | 1.58E-89 | 8.31E-177 | mr1055_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215966676 | 1.39E-45 | 7.24E-93 | mr1055_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215966676 | 4.36E-33 | 1.04E-53 | mr1055_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215966676 | NA | 2.43E-06 | mr1064_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215966676 | 1.25E-53 | 6.34E-165 | mr1079_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215966676 | 2.08E-34 | 7.30E-78 | mr1079_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215966676 | 6.63E-17 | 2.24E-38 | mr1079_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215966676 | NA | 1.04E-10 | mr1089_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215966676 | NA | 5.11E-11 | mr1093_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215966676 | NA | 6.04E-09 | mr1109_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215966676 | 8.32E-81 | 1.39E-228 | mr1132_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215966676 | 2.66E-30 | 4.89E-71 | mr1132_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215966676 | 4.73E-37 | 7.75E-70 | mr1132_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215966676 | 2.28E-69 | 1.08E-213 | mr1178_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215966676 | 4.51E-39 | 2.37E-91 | mr1178_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215966676 | 6.13E-28 | 5.72E-57 | mr1178_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215966676 | NA | 3.55E-07 | mr1193_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215966676 | NA | 3.37E-11 | mr1235_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215966676 | NA | 1.74E-07 | mr1243_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215966676 | NA | 2.45E-08 | mr1251_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215966676 | 2.04E-18 | 6.77E-69 | mr1261_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215966676 | 2.00E-14 | 9.61E-23 | mr1261_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215966676 | NA | 3.67E-16 | mr1301_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215966676 | 2.17E-80 | 2.12E-208 | mr1390_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215966676 | 9.37E-40 | 9.92E-89 | mr1390_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215966676 | 1.26E-38 | 1.94E-70 | mr1390_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215966676 | NA | 4.23E-06 | mr1423_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215966676 | NA | 2.12E-08 | mr1435_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215966676 | 2.32E-06 | 2.32E-06 | mr1456_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215966676 | 9.89E-52 | 5.30E-163 | mr1489_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215966676 | 8.02E-18 | 2.80E-33 | mr1489_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215966676 | 5.12E-18 | 1.39E-37 | mr1489_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215966676 | 2.53E-67 | 2.90E-195 | mr1490_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215966676 | 2.39E-33 | 1.88E-74 | mr1490_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215966676 | 9.22E-41 | 1.10E-74 | mr1490_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215966676 | 4.61E-07 | 5.74E-47 | mr1546_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215966676 | 1.34E-06 | 2.54E-17 | mr1546_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215966676 | NA | 2.82E-08 | mr1577_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215966676 | 1.68E-07 | 4.97E-12 | mr1577_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215966676 | NA | 1.88E-06 | mr1580_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215966676 | NA | 2.96E-17 | mr1587_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215966676 | 2.48E-06 | 2.69E-13 | mr1587_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215966676 | NA | 1.04E-10 | mr1599_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215966676 | NA | 8.68E-07 | mr1682_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215966676 | NA | 1.89E-06 | mr1754_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215966676 | 1.12E-24 | 2.70E-100 | mr1778_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215966676 | 3.25E-13 | 6.30E-28 | mr1778_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215966676 | NA | 6.82E-38 | mr1780_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215966676 | 9.69E-06 | 1.27E-09 | mr1780_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215966676 | NA | 2.79E-10 | mr1792_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215966676 | 2.81E-07 | 4.44E-14 | mr1792_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215966676 | 2.97E-07 | 2.26E-12 | mr1803_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215966676 | NA | 4.05E-43 | mr1805_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215966676 | NA | 1.59E-10 | mr1805_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |