Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1215958506:

Variant ID: vg1215958506 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 15958506
Reference Allele: T	Alternative Allele: A
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, others allele: 0.00, population size: 250. )

Flanking Sequence (100 bp) in Reference Genome:

AGTAGGTAAGATTGTAAAAATAAAGTCCTTTTACCAAGTTGAAAGGCTCGAAATAGTTTTTTTTTTACAGTCAGTGTCTTAGTTATTTCATTCTCTACAC[T/A]
GCAGATAAAACGGTTGTAAGCCCGTAATCTGTTTTTTCTATGTAAATTCCTCTCGGAAGGAAAGGATTATTGATTTTCTTTTTGATCAAGCTTTAATCAA

Reverse complement sequence

TTGATTAAAGCTTGATCAAAAAGAAAATCAATAATCCTTTCCTTCCGAGAGGAATTTACATAGAAAAAACAGATTACGGGCTTACAACCGTTTTATCTGC[A/T]
GTGTAGAGAATGAAATAACTAAGACACTGACTGTAAAAAAAAAACTATTTCGAGCCTTTCAACTTGGTAAAAGGACTTTATTTTTACAATCTTACCTACT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	53.80%	40.40%	0.13%	5.73%	NA
All Indica	2759	29.40%	67.60%	0.14%	2.86%	NA
All Japonica	1512	86.40%	1.30%	0.13%	12.24%	NA
Aus	269	99.30%	0.70%	0.00%	0.00%	NA
Indica I	595	18.80%	81.20%	0.00%	0.00%	NA
Indica II	465	26.70%	63.20%	0.43%	9.68%	NA
Indica III	913	33.80%	64.30%	0.00%	1.86%	NA
Indica Intermediate	786	33.70%	63.90%	0.25%	2.16%	NA
Temperate Japonica	767	98.70%	1.00%	0.00%	0.26%	NA
Tropical Japonica	504	64.70%	1.60%	0.20%	33.53%	NA
Japonica Intermediate	241	92.50%	1.20%	0.41%	5.81%	NA
VI/Aromatic	96	97.90%	2.10%	0.00%	0.00%	NA
Intermediate	90	72.20%	20.00%	0.00%	7.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1215958506	T -> DEL	N	N	silent_mutation	Average:28.475; most accessible tissue: Callus, score: 65.865	N	N	N	N
vg1215958506	T -> A	LOC_Os12g27200.1	upstream_gene_variant ; 4220.0bp to feature; MODIFIER	silent_mutation	Average:28.475; most accessible tissue: Callus, score: 65.865	N	N	N	N
vg1215958506	T -> A	LOC_Os12g27190.1	intron_variant ; MODIFIER	silent_mutation	Average:28.475; most accessible tissue: Callus, score: 65.865	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1215958506	5.35E-06	NA	mr1016	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215958506	NA	8.00E-14	mr1022	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215958506	NA	3.35E-10	mr1023	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215958506	NA	3.54E-12	mr1079	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215958506	4.66E-07	NA	mr1178	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215958506	6.77E-07	3.05E-12	mr1178	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215958506	NA	1.27E-11	mr1390	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215958506	NA	1.27E-41	mr1458	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215958506	NA	1.28E-11	mr1490	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215958506	NA	2.59E-09	mr1546	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215958506	NA	2.21E-07	mr1707	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215958506	5.78E-06	NA	mr1022_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215958506	NA	3.21E-15	mr1022_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215958506	NA	3.38E-11	mr1023_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215958506	5.45E-06	NA	mr1055_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215958506	9.13E-07	5.23E-15	mr1055_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215958506	3.09E-06	NA	mr1079_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215958506	1.59E-07	1.73E-16	mr1079_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215958506	6.98E-07	1.46E-15	mr1132_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215958506	NA	1.19E-14	mr1178_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215958506	8.08E-07	NA	mr1390_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215958506	1.51E-07	7.48E-16	mr1390_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215958506	NA	6.37E-47	mr1458_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215958506	NA	2.24E-10	mr1489_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215958506	1.76E-06	NA	mr1490_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215958506	7.92E-07	3.72E-14	mr1490_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251