\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1215958506:

Variant ID: vg1215958506 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 15958506
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, others allele: 0.00, population size: 250. )

Flanking Sequence (100 bp) in Reference Genome:


AGTAGGTAAGATTGTAAAAATAAAGTCCTTTTACCAAGTTGAAAGGCTCGAAATAGTTTTTTTTTTACAGTCAGTGTCTTAGTTATTTCATTCTCTACAC[T/A]
GCAGATAAAACGGTTGTAAGCCCGTAATCTGTTTTTTCTATGTAAATTCCTCTCGGAAGGAAAGGATTATTGATTTTCTTTTTGATCAAGCTTTAATCAA

Reverse complement sequence

TTGATTAAAGCTTGATCAAAAAGAAAATCAATAATCCTTTCCTTCCGAGAGGAATTTACATAGAAAAAACAGATTACGGGCTTACAACCGTTTTATCTGC[A/T]
GTGTAGAGAATGAAATAACTAAGACACTGACTGTAAAAAAAAAACTATTTCGAGCCTTTCAACTTGGTAAAAGGACTTTATTTTTACAATCTTACCTACT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 53.80% 40.40% 0.13% 5.73% NA
All Indica  2759 29.40% 67.60% 0.14% 2.86% NA
All Japonica  1512 86.40% 1.30% 0.13% 12.24% NA
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 18.80% 81.20% 0.00% 0.00% NA
Indica II  465 26.70% 63.20% 0.43% 9.68% NA
Indica III  913 33.80% 64.30% 0.00% 1.86% NA
Indica Intermediate  786 33.70% 63.90% 0.25% 2.16% NA
Temperate Japonica  767 98.70% 1.00% 0.00% 0.26% NA
Tropical Japonica  504 64.70% 1.60% 0.20% 33.53% NA
Japonica Intermediate  241 92.50% 1.20% 0.41% 5.81% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 72.20% 20.00% 0.00% 7.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1215958506 T -> DEL N N silent_mutation Average:28.475; most accessible tissue: Callus, score: 65.865 N N N N
vg1215958506 T -> A LOC_Os12g27200.1 upstream_gene_variant ; 4220.0bp to feature; MODIFIER silent_mutation Average:28.475; most accessible tissue: Callus, score: 65.865 N N N N
vg1215958506 T -> A LOC_Os12g27190.1 intron_variant ; MODIFIER silent_mutation Average:28.475; most accessible tissue: Callus, score: 65.865 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1215958506 5.35E-06 NA mr1016 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215958506 NA 8.00E-14 mr1022 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215958506 NA 3.35E-10 mr1023 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215958506 NA 3.54E-12 mr1079 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215958506 4.66E-07 NA mr1178 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215958506 6.77E-07 3.05E-12 mr1178 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215958506 NA 1.27E-11 mr1390 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215958506 NA 1.27E-41 mr1458 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215958506 NA 1.28E-11 mr1490 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215958506 NA 2.59E-09 mr1546 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215958506 NA 2.21E-07 mr1707 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215958506 5.78E-06 NA mr1022_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215958506 NA 3.21E-15 mr1022_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215958506 NA 3.38E-11 mr1023_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215958506 5.45E-06 NA mr1055_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215958506 9.13E-07 5.23E-15 mr1055_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215958506 3.09E-06 NA mr1079_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215958506 1.59E-07 1.73E-16 mr1079_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215958506 6.98E-07 1.46E-15 mr1132_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215958506 NA 1.19E-14 mr1178_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215958506 8.08E-07 NA mr1390_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215958506 1.51E-07 7.48E-16 mr1390_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215958506 NA 6.37E-47 mr1458_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215958506 NA 2.24E-10 mr1489_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215958506 1.76E-06 NA mr1490_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215958506 7.92E-07 3.72E-14 mr1490_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251