\
| Variant ID: vg1215956379 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 15956379 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
CGCGGTCAAACCGGCGCAGCCCGCGGTCTAACCGGCCGACACTATGTCAGTTTCGGTTTCGGGTTGTTTATTTATATATCTGAGTTTATTTCATGATTAT[G/A]
GCTTCTAGATGGATACTATACGTATGTAATACTATTGTTTGCTGCTAATGAGTCAAGTTGAAGATAGCTTGGTCTCGGAATATGGTTTCTTTGTTTATTC
GAATAAACAAAGAAACCATATTCCGAGACCAAGCTATCTTCAACTTGACTCATTAGCAGCAAACAATAGTATTACATACGTATAGTATCCATCTAGAAGC[C/T]
ATAATCATGAAATAAACTCAGATATATAAATAAACAACCCGAAACCGAAACTGACATAGTGTCGGCCGGTTAGACCGCGGGCTGCGCCGGTTTGACCGCG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 88.70% | 5.60% | 0.68% | 4.99% | NA |
| All Indica | 2759 | 97.20% | 0.40% | 0.11% | 2.28% | NA |
| All Japonica | 1512 | 74.30% | 13.10% | 1.59% | 11.04% | NA |
| Aus | 269 | 98.50% | 0.70% | 0.74% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 91.60% | 0.20% | 0.00% | 8.17% | NA |
| Indica III | 913 | 98.00% | 0.50% | 0.00% | 1.42% | NA |
| Indica Intermediate | 786 | 97.60% | 0.50% | 0.38% | 1.53% | NA |
| Temperate Japonica | 767 | 98.40% | 1.20% | 0.13% | 0.26% | NA |
| Tropical Japonica | 504 | 33.70% | 32.70% | 3.57% | 29.96% | NA |
| Japonica Intermediate | 241 | 82.20% | 10.00% | 2.07% | 5.81% | NA |
| VI/Aromatic | 96 | 45.80% | 52.10% | 2.08% | 0.00% | NA |
| Intermediate | 90 | 85.60% | 6.70% | 1.11% | 6.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1215956379 | G -> DEL | N | N | silent_mutation | Average:12.123; most accessible tissue: Zhenshan97 panicle, score: 20.424 | N | N | N | N |
| vg1215956379 | G -> A | LOC_Os12g27190.1 | upstream_gene_variant ; 1144.0bp to feature; MODIFIER | silent_mutation | Average:12.123; most accessible tissue: Zhenshan97 panicle, score: 20.424 | N | N | N | N |
| vg1215956379 | G -> A | LOC_Os12g27180-LOC_Os12g27190 | intergenic_region ; MODIFIER | silent_mutation | Average:12.123; most accessible tissue: Zhenshan97 panicle, score: 20.424 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1215956379 | 5.05E-06 | NA | mr1017 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215956379 | 3.43E-06 | 3.35E-10 | mr1017 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215956379 | 1.44E-08 | NA | mr1019 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215956379 | NA | 9.55E-09 | mr1019 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215956379 | 2.00E-06 | NA | mr1023 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215956379 | 6.85E-07 | NA | mr1023 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215956379 | 5.46E-06 | NA | mr1051 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215956379 | 5.47E-08 | NA | mr1055 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215956379 | 7.65E-07 | 2.64E-11 | mr1055 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215956379 | NA | 2.53E-06 | mr1083 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215956379 | 5.97E-09 | NA | mr1132 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215956379 | 1.24E-07 | 2.40E-12 | mr1132 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215956379 | 9.03E-06 | NA | mr1289 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215956379 | NA | 1.09E-06 | mr1364 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215956379 | 1.55E-08 | NA | mr1390 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215956379 | 3.69E-06 | NA | mr1390 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215956379 | NA | 1.39E-06 | mr1443 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215956379 | 2.24E-06 | NA | mr1489 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215956379 | 1.01E-08 | NA | mr1490 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215956379 | 1.14E-06 | NA | mr1490 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215956379 | 7.22E-06 | NA | mr1491 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215956379 | 1.96E-06 | NA | mr1778 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215956379 | 7.77E-06 | NA | mr1019_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215956379 | 8.75E-08 | NA | mr1055_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215956379 | 4.88E-09 | NA | mr1132_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215956379 | 3.72E-06 | NA | mr1132_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215956379 | 2.15E-06 | NA | mr1261_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215956379 | 2.65E-06 | NA | mr1390_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215956379 | 7.36E-07 | NA | mr1489_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215956379 | 5.08E-07 | NA | mr1490_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215956379 | 2.50E-06 | NA | mr1778_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |